Displaying 20 results from an estimated 200 matches similar to: "Rwave cgt plot time axis problem"
2013 Apr 19
1
How to select the scale parameter for Gabor transform (Rwave)?
Dear list,
I am trying to choose the scale parameter for the cgt transform but I don't
know how to do it. In time I would like to be able to separate points 30
samples apart, and in frequency I would like to separate bands 0.04 Hz
apart. I tried the two approaches described below and they gave me
different results. I would appreciate advise on how to do this.
The Rwave Gabor transform uses
2012 Oct 08
1
[LLVMdev] Fwd: Multiply i8 operands promotes to i32
Hello Pedro,
As others have said we're assuming that you're using Clang as the frontend,
the MSP430TargetInfo class inside lib/Basic/Targets.cpp (clang codebase)
set ints to be 16 bits wide, so you should get 16bit mults straight away
without promotion. But anyways for 8bit multiplicantions you can do the
following to bypass argument promotion:
1) go to the lib/CodeGen/TargetInfo.cpp
2009 Jun 04
1
Morlet wavelet analysis
Dear,
I am using "cwt "function from Rwave package to perform Morlet wavelet analysis.
d1<-c(1.31673209591515, -0.171333455797346, -1.67618546079420,
-0.931604651010362, -0.954614183224057, -1.19821794547758, 0.516096363353144,
-0.0432811977638559, 0.737764943619919, 0.438046629673177, -0.208607167908743,
-0.3091308821262, -1.42473112931594, 0.234125312118165, -0.307047554490597,
2006 Apr 13
1
Guidance on step() with large dataset (750K) solicited...
Hi.
Background - I am working with a dataset involving around 750K
observations, where many of the variables (8/11) are unordered factors.
The typical model used to model this relationship in the literature has
been a simple linear additive model, but this is rejected out of hand by
the data. I was asked to model this via kernel methods, but first wanted
to play with the parametric
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2008 Dec 02
1
help with package Rwave
I am looking for some explanations about the usage of the poorely documented R paclkage Rwave.
Has anyone ever tried out its functions for Wavelet Analysis ?
Thank you so much.
Maura
Alice Messenger ;-) chatti anche con gli amici di Windows Live Messenger e tutti i telefonini TIM!
Vai su http://maileservizi.alice.it/alice_messenger/index.html?pmk=footer
[[alternative HTML version deleted]]
2001 Jul 26
0
data for Rwave package
Hi,
I just installed the new Rwave package. On the Win2000 platform it will
not find its data files (it does fine under Linux).
Here is what I do:
(1) library(Rwave)
(2) data() - this correctly reports all the data sets
available
(3) data(HOWAREYOU) - this fails on Win2000 machine with the
following message
Error in file(file, "r") : cannot open file
2004 Sep 15
0
RWAVE axis notation
I am using Rwave wavelets and I need better axis notation.
Does anyone have code similar to
matlab's
centfreq
or
scale2frq
functions that turn a scale for a wavelet transform into
a good looking scale to plot on my wavelet transfoms?
I am using the rwave package to investigate
seismic signals from an exploding volcano.
Jonathan Lees
--
==========================================
2014 Oct 18
3
[LLVMdev] Performance regression on ARM
Hi Chandler,
That's embarrassing how weird this part of clang is. I have a provisional
patch which fixes the problem but underlines clang's problems. I will
submit it tonight for comments.
суббота, 18 октября 2014 г. пользователь Chandler Carruth написал:
>
> On Fri, Oct 17, 2014 at 7:51 AM, Anton Korobeynikov <
> anton at korobeynikov.info
>
2007 Jan 28
2
reposTools
Dear List,
I tested the example in the reposTools vignette:
library(reposTools);
Loading required package: tools
genRepos("Test
Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos");
Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep'
Could someone help me out with this one?
I'd appreciate all help....
I am
2010 Aug 31
1
wavelet parameters with sowas
Hello everybody.
My name is Angela.
I'm doing wavelet using the sowas library. The problem I have is that I
don't know how to choose the paremeters to describes differnt wavelet
analysis. How I select the noctave, nvoice, w0, s0,...?
I hope my question is clear enough.
Thank you very much beforehand.
Angela
--
View this message in context:
2007 Dec 11
1
Using predict()?
I'm trying to solve a homework problem using R. The problem gives a list
of cricket chirps per second and corresponding temperature, and asks to
give the equation for the linear model and then predict the temperature
to produce 18 chirps per second. So far, I have:
> # Homework 11.2.1 and 11.3.3
> chirps <- scan()
1: 20
2: 16
3: 19.8
4: 18.4
5: 17.1
6: 15.5
7: 14.7
8: 17.1
9: 15.4
2003 Jun 25
1
indication tones and callwaiting chirp too loud
I am wondering if anyone could help me figure out how to turn down the volume on all the dial tones, indications, etc.. and especially the call-waiting CHIRP!
I don't want to change the txgain and rxgain because they are working at levels that I would like. However, when voice conversations and voicemail recordings are at good levels then the dial tones, busy tones, etc are way too loud.
2010 Aug 02
3
OT -- apcupsd messages
Does anyone here have any "feel" for the "Battery disconnected" and
"Battery reattached" log entries?
The rebooting came as a result of me turning off modems, router,
external drives, monitor, cordless phone and finally, the computer,
trying to locate a quiet but annoying "chirp". The "chirps" stopped
when I tilted the UPS to look at the front
2007 Sep 05
7
Can asterisk give half-ring periodically for MWI?
Hi all,
Configuration: Analog phone connected to TDM400p.
I'd like the phone to give a half-ring (chirp) periodically when there
is a message waiting. Can this be done? How is it configured?
The visible "Message waiting" indicator and the stutter dial tone are
working fine, but are not sufficient for me.
Thanks!
2005 Feb 01
1
broken message waiting indicator on Polycom IP600?
Hello,
I faithfully followed the instructions from:
http://www.voip-info.org/wiki-Getting+MWI+on+Polycom+Phones+to+work+with+Asterisk
but still the message waiting indicator doesn't flash when a message is
waiting. There is a brief intermittent chirp but nothing more.
Using latest firmware 1.4.1
Thanks for your suggestions,
2003 Aug 06
3
X-Lite <-> Snom200
Hi,
I have just been playing with the latest X-Lite.. It works fine with Asterisk..
As for codecs I tested G.711a/u, GSM and iLBC... iLBC is the only one that didn't work.. not sure why..
But the bigger problem is that when I call another extension that is using a Snom200 the call connects but there is no audio in either direction.. I have tried G.711a/u and GSM and while X-Lite shows that
2004 Nov 19
2
app_sms: problems sending a sms
Hello,
i try to send out a sms, but with no success.
The trunk is a E100P, and the sms should go out to the
Telekom SM-SC. What i want to to at the first run is,
sending out a sms when a certain number is dialed.
I tried:
In extensions.conf:
exten => 35953,1,SMS(${TRUNK}/9350193010,,0179NUMBER,"Hi there")
exten => 35953,2,SMS(${TRUNK}/9350193010)
exten => 35953,3,Hangup
2003 Nov 20
2
ADSI Hold
Is there any way to program a soft key in ADSI to put a caller on hold.
Then able to retreive that caller.
Example -
Softkey Hold
Softkey Retreive Call
Softkey End Call
-gcc
2007 Apr 27
9
can''t mount vfat fs on lvm created by winxp guest
Greetings,
I''ve had no success with mounting a vfat file system created by a
Windows XP guest on a lvm volume.
# mount -t vfat /dev/vg1/win1 /mnt/
mount: wrong fs type, bad option, bad superblock on /dev/vg1/win1,
missing codepage or other error
In some cases useful info is found in syslog - try
dmesg | tail or so
# dmesg
FAT: invalid media value (0xb9)
VFS: