Displaying 20 results from an estimated 200 matches similar to: "Re: RArcInfo question(basic=T, newbie=T, annoying=T)"
2002 Mar 12
1
RArcInfo Package, get.bnddata()
I am having trouble using get.bnddata() in the RArcInfo package. I
installed the version 0.2 binary of the package for Windows and am using R
1.4.1 on Windows NT 4.0. I have had no problems importing and plotting arc
data with get.arcdata() and plotarc(). plotpal() also works fine. I've
been able to use get.arcdata(), get.labdata(), get.paldata(),
get.tablenames(), get.tablefields(),
2002 Dec 04
0
RArcInfo 0.4-2 and tutorial (draft) available
Hi,
A new release of RArcInfo is avaialable from CRAN and
http://matheron.uv.es/~virgil/Rpackages/RArcInfo/
The changes made are:
*V 0.4-2
- 'index' argument added to plotarc to select the arcs to plot.
- 'index' argument added to plotpal to select the polygons to plot.
- New function 'get.nb', which, given a set of polygons, returns
the neighbouring polygons of
2002 Dec 04
0
RArcInfo 0.4-2 and draft tutorial out
Hi,
A new release of RArcInfo is out, together with a draft of the tutorial.
You can get both from
http://matheron.estadi.uv.es/~virgil/Rpackages/RArcInfo
Windows binaries are also available and package source can also be
downloaded from CRAN.
I 'd like to encourage users of the package to read the tutorial and
report ideas. Besides, I would like to keep a web page on works where
RArcInfo is
2002 Nov 22
0
RArcInfo:Â can't read arc coverage
Dear all,
> On the advice of Virgilio, I converted my Arc v.8x coverage into v.7x, but
> that made no difference (ESRI documenation says they should be the same anyway).
D. Morisette has also reported some 'weird' coverages, which do not
follow the standards. Perhaps you have one of them. Please, take a look
at http://pages.infinit.net/danmo/e00/docs/v7_bin_cover.html
Anyway,
2002 Nov 21
0
RArcInfo: can't read arc coverage
I am having trouble using get.arcdata() in RArcInfo. X and y coordinates
are not what they should be. Can anyone suggest what might be wrong?
I am using RArcInfo 0.4-1.
Here is the metadata of my coverage, using describe in Arc:
Arc: describe stdir_6
Description of SINGLE precision coverage stdir_6
FEATURE CLASSES
2002 Nov 14
1
Problems when plotting (related to RArcInfo)
Hello,
I am using RArcInfo to create some maps but, once I have plotted the map
(using plotarc), I try to add new lines, but the fact is that they are
not plotted.
I have reviewing the code, and if I remove a line, everything works
fine, but I am not sure whether I should do that, because that line
restores the previous 'par' profile.
Here is a portion of the code (from plotarc.R):
2013 Apr 09
4
Converting matrix to data frame without losing an assigned dimname
Hello All,
Would like to be able to convert a matrix to a dataframe without losing an assigned dimname.
Here is an example that should illustrate what I'm talking about.
tableData <- state.x77[c(7, 38, 20, 46), c(7, 1, 8)]
names(dimnames(tableData)) <- c("State", "")
tableData
State Frost Population Area
Connecticut 139 3100 4862
2002 Jul 19
3
controling graphic window size and asprec ratio in windows
i am using the rarcinfo package
to draw maps.
for maps, th aspect ratio is quite important.
how can i control the aspect ratio and the size of a graphics window
in the mswindows version of R and more generally in R in general.
i would like to e able to both set the size before or while the window
is corrected,
and also for a window which already exists.
--
--
Erich Neuwirth, Computer Supported
2009 Jan 13
1
Converting Factor to Vector
Hi all,
How can I convert factor like this:
> str(repo)
'data.frame': 1000 obs. of 1 variable:
$ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ...
> print(repo)
AAA
1 AAA
2 AAT
3 AAC
...
into to simple vector
> str(new_repo)
chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...
2002 Aug 26
0
Re: RArcInfo 0.3 (fwd)
Hi,
I have been thinking about your questions and comments. And I think I have
the answers. :D
> the way you draw the polygons has the consequence that if the larger one
> is drawn after the smaller one,
> the color of the smaller one is "overwritten"
> and therefore the map is really wrong in the relevant area.
> so this needs fixing.
Another approach is sorting the
2006 Mar 28
3
Brand newbie question relating to link_to
I recently dived into Rails and am having trouble with the link_to method.
I''d like to pass some parameters to the action being called and am not sure
how to do it. Essentially, I want to hyperlink a total count of bugs
queried from the database to a method that will return the bug numbers when
clicked on. I have a method, bug_total, that returns the total number to
display in the
2001 Mar 29
1
reading big arrays from C
hello.
I am trying to read a big file with different sections each with a
different format, actually it is a map in format *.e00 of MapView.
I can read the whole file with no problems from R using scan()
but it takes too long, some files are 50 meg and have to be read line
by line to catch the section codes.
So if I do the reading from C would it be faster?
if it is, how do I manage with the
2009 Jan 13
3
Returning Non-Unique Index with Which (alternatives?)
Dear all,
I tried to find index in repo given a query with this:
> repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT")
> qr <- c("AAC", "ATT", "ATT")
> which(repo%in%qr)
[1] 3 6
Note that the query contain repeating elements, yet
the output of which only returns unique.
How can I make it
2009 Nov 04
1
odfweave table styles
Hello List,
Does anyone have examples of custom formatting of tables in odfweave? I know
there is an example of this in the formatting.odt file that comes with the
package, but running that through odfweave gives the following error:
Error: chunk 13 (label=showTableStyles)
Error in names(x) <- value :
'names' attribute [1] must be the same length as the vector [0]
What I am really
2003 Jan 08
2
Maps in R
Is there a way to generate maps in R. Specifically, I have calculated
estimates of intra-regional inequality for US states, and would like to
project that information onto a map.
Thanks,
Nirmala
2007 Jan 21
1
for loop problem
Hello R users,
A beginners question which I could not find the answer to in earler posts.
My thought process:
Here "z" is a 119 x 15 data matrix
Step 1: start at column one, bind every column with column 1
Step2: use the new matrix, "test", in the fitCopula package
Step3: store each result in myfit, bind each result to "answer"
Step4: return "answer"
2009 May 06
2
Help with lme4 model specification
I am new to R and am trying to specify a model for mixed model analysis.
When I run the following model I get an error:
AAT<- lmer(Y ~ S + A + (1|S:A/H), data=AT, REML=True)
The error looks like this:
Error in Spar_loc:`:` : NA/NaN argument
In addition: Warning messages:
1: In model.matrix.default(mt, mf, contrasts) :
variable 'Spar_loc' converted to a factor
2: In Spar_loc:`:` :
2005 May 09
1
Interfacing AT&T Spirit System to Asterisk
Greetings,
Does anyone know if there is a cost effective way to interface an
older AT&T Spirit system into Asterisk.
I'm only interested in A) being able to offer voicemail and B)
possibly an AAT to callers.
I've thought about just stringing the FXO cards into the line1/2 slots
that go into the Spirit system... asterisk would pickup if no one
answered the Spirit phones....
however....
2003 Oct 10
1
R(D)-COM stat conenctor for ArcGIS
Hi everybody,
I heard about "R(D)-COM Stat connector" for ArcGIS, but i am not
sure what that is. I did a search in the archive but it seems i am
not getting anything back.
can anybody explain me what that is, and where i can find more
info about it? There is any possibility to run R from inside
ArcGIS?
there is more than RArcInfo and Shapefile which can
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>