similar to: Re: RArcInfo question(basic=T, newbie=T, annoying=T)

I am having trouble using get.bnddata() in the RArcInfo package. I installed the version 0.2 binary of the package for Windows and am using R 1.4.1 on Windows NT 4.0. I have had no problems importing and plotting arc data with get.arcdata() and plotarc(). plotpal() also works fine. I've been able to use get.arcdata(), get.labdata(), get.paldata(), get.tablenames(), get.tablefields(),

Hi, A new release of RArcInfo is avaialable from CRAN and http://matheron.uv.es/~virgil/Rpackages/RArcInfo/ The changes made are: *V 0.4-2 - 'index' argument added to plotarc to select the arcs to plot. - 'index' argument added to plotpal to select the polygons to plot. - New function 'get.nb', which, given a set of polygons, returns the neighbouring polygons of

Hi, A new release of RArcInfo is out, together with a draft of the tutorial. You can get both from http://matheron.estadi.uv.es/~virgil/Rpackages/RArcInfo Windows binaries are also available and package source can also be downloaded from CRAN. I 'd like to encourage users of the package to read the tutorial and report ideas. Besides, I would like to keep a web page on works where RArcInfo is

Dear all, > On the advice of Virgilio, I converted my Arc v.8x coverage into v.7x, but > that made no difference (ESRI documenation says they should be the same anyway). D. Morisette has also reported some 'weird' coverages, which do not follow the standards. Perhaps you have one of them. Please, take a look at http://pages.infinit.net/danmo/e00/docs/v7_bin_cover.html Anyway,

I am having trouble using get.arcdata() in RArcInfo. X and y coordinates are not what they should be. Can anyone suggest what might be wrong? I am using RArcInfo 0.4-1. Here is the metadata of my coverage, using describe in Arc: Arc: describe stdir_6 Description of SINGLE precision coverage stdir_6 FEATURE CLASSES

Hello, I am using RArcInfo to create some maps but, once I have plotted the map (using plotarc), I try to add new lines, but the fact is that they are not plotted. I have reviewing the code, and if I remove a line, everything works fine, but I am not sure whether I should do that, because that line restores the previous 'par' profile. Here is a portion of the code (from plotarc.R):

Hello All, Would like to be able to convert a matrix to a dataframe without losing an assigned dimname. Here is an example that should illustrate what I'm talking about. tableData <- state.x77[c(7, 38, 20, 46), c(7, 1, 8)] names(dimnames(tableData)) <- c("State", "") tableData State Frost Population Area Connecticut 139 3100 4862

i am using the rarcinfo package to draw maps. for maps, th aspect ratio is quite important. how can i control the aspect ratio and the size of a graphics window in the mswindows version of R and more generally in R in general. i would like to e able to both set the size before or while the window is corrected, and also for a window which already exists. -- -- Erich Neuwirth, Computer Supported

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...

Hi, I have been thinking about your questions and comments. And I think I have the answers. :D > the way you draw the polygons has the consequence that if the larger one > is drawn after the smaller one, > the color of the smaller one is "overwritten" > and therefore the map is really wrong in the relevant area. > so this needs fixing. Another approach is sorting the

I recently dived into Rails and am having trouble with the link_to method. I''d like to pass some parameters to the action being called and am not sure how to do it. Essentially, I want to hyperlink a total count of bugs queried from the database to a method that will return the bug numbers when clicked on. I have a method, bug_total, that returns the total number to display in the

hello. I am trying to read a big file with different sections each with a different format, actually it is a map in format *.e00 of MapView. I can read the whole file with no problems from R using scan() but it takes too long, some files are 50 meg and have to be read line by line to catch the section codes. So if I do the reading from C would it be faster? if it is, how do I manage with the

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

Hello List, Does anyone have examples of custom formatting of tables in odfweave? I know there is an example of this in the formatting.odt file that comes with the package, but running that through odfweave gives the following error: Error: chunk 13 (label=showTableStyles) Error in names(x) <- value : 'names' attribute [1] must be the same length as the vector [0] What I am really

Is there a way to generate maps in R. Specifically, I have calculated estimates of intra-regional inequality for US states, and would like to project that information onto a map. Thanks, Nirmala

Hello R users, A beginners question which I could not find the answer to in earler posts. My thought process: Here "z" is a 119 x 15 data matrix Step 1: start at column one, bind every column with column 1 Step2: use the new matrix, "test", in the fitCopula package Step3: store each result in myfit, bind each result to "answer" Step4: return "answer"

I am new to R and am trying to specify a model for mixed model analysis. When I run the following model I get an error: AAT<- lmer(Y ~ S + A + (1|S:A/H), data=AT, REML=True) The error looks like this: Error in Spar_loc:`:` : NA/NaN argument In addition: Warning messages: 1: In model.matrix.default(mt, mf, contrasts) : variable 'Spar_loc' converted to a factor 2: In Spar_loc:`:` :

Greetings, Does anyone know if there is a cost effective way to interface an older AT&T Spirit system into Asterisk. I'm only interested in A) being able to offer voicemail and B) possibly an AAT to callers. I've thought about just stringing the FXO cards into the line1/2 slots that go into the Spirit system... asterisk would pickup if no one answered the Spirit phones.... however....

Hi everybody, I heard about "R(D)-COM Stat connector" for ArcGIS, but i am not sure what that is. I did a search in the archive but it seems i am not getting anything back. can anybody explain me what that is, and where i can find more info about it? There is any possibility to run R from inside ArcGIS? there is more than RArcInfo and Shapefile which can

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >