Displaying 20 results from an estimated 4000 matches similar to: "OK.rb''s First Meeting"
2006 Mar 08
0
OK.rb meeting on March 14th
Just a quick reminder that OK.rb will be having its first meeting March 14th at
7 PM. You can get more info by going to:
http://www.rubyholic.com/groups/show/79
Grant
1997 Dec 12
0
happy with Samba
I wish to thank all those responsible for Samba and the web site, and
especially the person who compiled Samba for Irix 6.2. I do not have a
compiler on my machine yet, nor the knowledge to use one. I'll be installing
gcc soon to coincide with my class in C++.
I own a very small business with one SGI box and one PC, and Samba is a
great convenience. I installed the software with no problems,
2006 Mar 25
1
Some moved or copied messages get stuck in tmp
Hello.
I have seen in recent posts that there are other people
with this problem, and it is very important for me, as it
is the only cause for not putting Dovecot in production in
all mail servers in my University.
When moving/copying messages, some of them get stuck in the
tmp directory of the destination folder, effectively lost for
the user.
I have been tracing the problem, and it looks that
2006 Mar 01
3
Form helpers and overloaded methods - help!
Can someone explain why form helpers appear to bypass any model methods
I override for fields that are bound to database fields? It would be
great if someone could tell me how to force the form field, etc to call
the method instead of looking at the database / attributes collection.
Let''s say I have a column called ''price'' in my database table "books"
2006 Jul 25
0
seqinr updated : release 1.0-5
Dear R users,
seqinR 1.0-5 has been released yesterday on CRAN, so that the source code
of the package should be available on all CRAN mirrors within the next 24h.
The updated package vignette is here:
http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf
User level visible changes are:
o A new function dotPlot() is now available.
2006 Jul 25
0
seqinr updated : release 1.0-5
Dear R users,
seqinR 1.0-5 has been released yesterday on CRAN, so that the source code
of the package should be available on all CRAN mirrors within the next 24h.
The updated package vignette is here:
http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf
User level visible changes are:
o A new function dotPlot() is now available.
2010 Jul 07
1
Director service for LMTP in 2.0rc1
Hello,
has anyone a running setup for LMTP proxy and the director service ?
pop3/imap/managesieve is properly working, but i have problems with
LMTP. I set it up as described in the conf.d/10-director.conf
From the user_db i get proxy=y and no proxyhost as described for imap/pop3
But lmtp is complaining about the missing host:
Jul 07 15:00:48 auth: Debug: master in: PASS 1
user56
2005 Apr 29
2
Windows List of Folders?
For windows, how can I list only the folders in some folder?
I was thinking that dir() and file.info() with isdir==TRUE being something
that might work.
These folders or directories are numerically named with no dot extension
names or other characters. Typically, these are 3132, 3334, ...
Here is what I tried. The last line is where I need more work.
pData="C:/Myfiles/R/Data/"
setwd
2005 May 13
3
List and Column Names in a Function?
In this simple function, how can I pass strings for index and column names
to the function? I've posted this type of question before and received no
response.
Maybe this example will be easier to understand and troubleshoot.
ds <- function(myds, vec) {myds[[vec]]*2}
ds1 <- c(X=list(1:10), Y=list(11:20))
ds(get("ds1"),get("Y"))
khobson at odot.org
Kenneth Ray
2000 Oct 11
1
Bug? (PR#690)
I don“t know if it is a bug, but what's wrong in the folloing (R version
1.1.1, August 15, 2000, under windows 98):
> x<-matrix(nrow=10, ncol=2)
> for (i in 1:10)
+ {
+ x[i][1]<-i
+ x[i][2]<-i^2
+ }
Warning messages:
1: number of items to replace is not a multiple of replacement length
2: number of items to replace is not a multiple of replacement length
3: number of items to
2007 Nov 07
2
Adding submenus to existing consol GUI menu
If possible I would like to add two sub-menus to the R Console under
Windows.
For example, I would like to add:
winMenuAddItem("File", "Load CSV...", "loadCSV()")
winMenuAddItem("File", "Save CSV...", "saveCSV()")
and have them appear under the initial 'File' item rather than add a new
'File' menu item. I seem to
2011 Apr 25
6
Unicorn / Daemontools
Hi -
I tried to get Daemontools and Unicorn working together a while back -
there are issues on USR2 restart because of the pid
change - I''m hoping someone in the community will have some
understanding of this issue
I documented my experience and eventual defeat here :
http://log.robotarmyma.de/post/2053448029/daemontools-ubuntu-rvm-bundler-unicorn-install
Any help would be received
2005 May 24
2
Missing Data Line Type?
I have a general question. Is there a setting that can be used for a
multiple line type? The situation is that I want a solid line between x
and y points but if the y point is missing, I want a dashed line type to
the next point. In other words, if point 1 to 2 exists, make that line
solid, otherwise, make it dashed up to the next existing x/y point.
Additionally, what plot type would you
2005 Jun 10
2
Default Format for Dates?
Is there anyway to preset date formats? I have a date from a cover.dbf
that is shown as this:
> cover$FINALREPOR
[1] "2003-06-24"
The numeric value in cover$FINALREPOR is 12227. I'd rather not create
another vector to hold the properly formatted date.
When I put this in a WordPerfect merge, I want the date to be June 24,
2003. I could take care of the problem in a
2009 May 04
2
Spree 0.8.0 Released (Rails eCommerce Project)
Spree is an open source ecommerce solution for Ruby on Rails.
http://spreecommerce.com/articles/2009/05/04/spree-0-8-0-released/
I''ll also be leading a BOF at RailsConf where we will be chatting
about Rails commerce so hopefully I''ll see you there!
Sean Schofield
Twitter: @railsdog
2005 Jun 23
1
Stop Warnings for Invalid Factor Level, NAs generated?
How can I stop the following warning from occuring?
invalid factor level, NAs generated in: "[<-.factor"(`*tmp*`, iseq, value =
structure(1, .Label = "12", class = "factor"))
The Label messages are for "5", "8", "12" and "46". I want the NAs to be
generated as needed.
Is this causing R to slow down by generating the warning
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2016 Mar 22
3
Automatically forwarding fresh Kerberos tickets?
In an environment where users use smart cards to authenticate on Windows and then use ssh to login to UNIX systems via GSSAPI, it is nigh impossible to renew/refresh the Kerberos credentials in the UNIX session. If the user fails to renew their credentials before they expire, the user is stuck and must log out and log back in to get valid tickets.
Meanwhile it is entirely likely that on the
2005 Apr 29
0
Windows list of Folders
Hi Kenneth:
I tried:
list.files(path="c:\\pctexv4\\samples")
and that worked just fine.
Hope this helps!
Sincerely,
Erin Hodgess
Associate Professor
Department of Computer and Mathematical Sciences
University of Houston - Downtown
mailto: hodgess at gator.uhd.edu
From: khobson at fd9ns01.okladot.state.ok.us
Subject: [R] Windows List of Folders?
X-BeenThere: r-help at
2005 May 31
1
Add Columns and Order for Rbind?
I am using rbind to add one list with one row to another master list. The
problem is that not all columns exist in both lists.
What methods would you recommend to reorder one list based on the column
names of another? If both sets have the same order and columns, I can
then use rbind. I can live with columns being added to the master list set
it makes the task easier using something like