similar to: OK.rb''s First Meeting

Just a quick reminder that OK.rb will be having its first meeting March 14th at 7 PM. You can get more info by going to: http://www.rubyholic.com/groups/show/79 Grant

I wish to thank all those responsible for Samba and the web site, and especially the person who compiled Samba for Irix 6.2. I do not have a compiler on my machine yet, nor the knowledge to use one. I'll be installing gcc soon to coincide with my class in C++. I own a very small business with one SGI box and one PC, and Samba is a great convenience. I installed the software with no problems,

Hello. I have seen in recent posts that there are other people with this problem, and it is very important for me, as it is the only cause for not putting Dovecot in production in all mail servers in my University. When moving/copying messages, some of them get stuck in the tmp directory of the destination folder, effectively lost for the user. I have been tracing the problem, and it looks that

Can someone explain why form helpers appear to bypass any model methods I override for fields that are bound to database fields? It would be great if someone could tell me how to force the form field, etc to call the method instead of looking at the database / attributes collection. Let''s say I have a column called ''price'' in my database table "books"

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

Dear R users, seqinR 1.0-5 has been released yesterday on CRAN, so that the source code of the package should be available on all CRAN mirrors within the next 24h. The updated package vignette is here: http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf User level visible changes are: o A new function dotPlot() is now available.

Hello, has anyone a running setup for LMTP proxy and the director service ? pop3/imap/managesieve is properly working, but i have problems with LMTP. I set it up as described in the conf.d/10-director.conf From the user_db i get proxy=y and no proxyhost as described for imap/pop3 But lmtp is complaining about the missing host: Jul 07 15:00:48 auth: Debug: master in: PASS 1 user56

For windows, how can I list only the folders in some folder? I was thinking that dir() and file.info() with isdir==TRUE being something that might work. These folders or directories are numerically named with no dot extension names or other characters. Typically, these are 3132, 3334, ... Here is what I tried. The last line is where I need more work. pData="C:/Myfiles/R/Data/" setwd

In this simple function, how can I pass strings for index and column names to the function? I've posted this type of question before and received no response. Maybe this example will be easier to understand and troubleshoot. ds <- function(myds, vec) {myds[[vec]]*2} ds1 <- c(X=list(1:10), Y=list(11:20)) ds(get("ds1"),get("Y")) khobson at odot.org Kenneth Ray

I don´t know if it is a bug, but what's wrong in the folloing (R version 1.1.1, August 15, 2000, under windows 98): > x<-matrix(nrow=10, ncol=2) > for (i in 1:10) + { + x[i][1]<-i + x[i][2]<-i^2 + } Warning messages: 1: number of items to replace is not a multiple of replacement length 2: number of items to replace is not a multiple of replacement length 3: number of items to

If possible I would like to add two sub-menus to the R Console under Windows. For example, I would like to add: winMenuAddItem("File", "Load CSV...", "loadCSV()") winMenuAddItem("File", "Save CSV...", "saveCSV()") and have them appear under the initial 'File' item rather than add a new 'File' menu item. I seem to

Hi - I tried to get Daemontools and Unicorn working together a while back - there are issues on USR2 restart because of the pid change - I''m hoping someone in the community will have some understanding of this issue I documented my experience and eventual defeat here : http://log.robotarmyma.de/post/2053448029/daemontools-ubuntu-rvm-bundler-unicorn-install Any help would be received

I have a general question. Is there a setting that can be used for a multiple line type? The situation is that I want a solid line between x and y points but if the y point is missing, I want a dashed line type to the next point. In other words, if point 1 to 2 exists, make that line solid, otherwise, make it dashed up to the next existing x/y point. Additionally, what plot type would you

Is there anyway to preset date formats? I have a date from a cover.dbf that is shown as this: > cover$FINALREPOR [1] "2003-06-24" The numeric value in cover$FINALREPOR is 12227. I'd rather not create another vector to hold the properly formatted date. When I put this in a WordPerfect merge, I want the date to be June 24, 2003. I could take care of the problem in a

Spree is an open source ecommerce solution for Ruby on Rails. http://spreecommerce.com/articles/2009/05/04/spree-0-8-0-released/ I''ll also be leading a BOF at RailsConf where we will be chatting about Rails commerce so hopefully I''ll see you there! Sean Schofield Twitter: @railsdog

How can I stop the following warning from occuring? invalid factor level, NAs generated in: "[<-.factor"(`*tmp*`, iseq, value = structure(1, .Label = "12", class = "factor")) The Label messages are for "5", "8", "12" and "46". I want the NAs to be generated as needed. Is this causing R to slow down by generating the warning

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

In an environment where users use smart cards to authenticate on Windows and then use ssh to login to UNIX systems via GSSAPI, it is nigh impossible to renew/refresh the Kerberos credentials in the UNIX session. If the user fails to renew their credentials before they expire, the user is stuck and must log out and log back in to get valid tickets. Meanwhile it is entirely likely that on the

Hi Kenneth: I tried: list.files(path="c:\\pctexv4\\samples") and that worked just fine. Hope this helps! Sincerely, Erin Hodgess Associate Professor Department of Computer and Mathematical Sciences University of Houston - Downtown mailto: hodgess at gator.uhd.edu From: khobson at fd9ns01.okladot.state.ok.us Subject: [R] Windows List of Folders? X-BeenThere: r-help at

I am using rbind to add one list with one row to another master list. The problem is that not all columns exist in both lists. What methods would you recommend to reorder one list based on the column names of another? If both sets have the same order and columns, I can then use rbind. I can live with columns being added to the master list set it makes the task easier using something like