similar to: seqinr updated : release 1.0-5

Dear useRs, the seqinR package contains utilities to import and analyze biological sequence data. For a general introduction see this document: http://pbil.univ-lyon1.fr/software/SeqinR//vignette.pdf Please do not use r-help for questions about seqinR or r-bugs for bug report about seqinR. Use instead the seqinR diffusion list: http://pbil.univ-lyon1.fr/software/SeqinR//mailing.php?lang=eng A

Dear useRs, the seqinR package contains utilities to import and analyze biological sequence data. For a general introduction see this document: http://pbil.univ-lyon1.fr/software/SeqinR//vignette.pdf Please do not use r-help for questions about seqinR or r-bugs for bug report about seqinR. Use instead the seqinR diffusion list: http://pbil.univ-lyon1.fr/software/SeqinR//mailing.php?lang=eng A

Dear R developers I am currently working on the seqinR package. The seqinR package allows a remote access to biological databases via a socket connection. We are using the functions socketConnection, writeLines and readLines to open the socket, send request to the server and receive response from the server respectively. Recently, a new function implemented in the socket server allows

Dear useRs, The seqinR package is a library of utilities to retrieve and analyse biological sequences. A new version of seqinR, seqinR 1.0-7, has been released on CRAN. Here is a summary of changes: o A new *experimental* function extractseqs() to download sequences thru zlib compressed sockets from an ACNUC server is released. Preliminary tests suggest that working with about 100,000

Dear useRs, The seqinR package is a library of utilities to retrieve and analyse biological sequences. A new version of seqinR, seqinR 1.0-7, has been released on CRAN. Here is a summary of changes: o A new *experimental* function extractseqs() to download sequences thru zlib compressed sockets from an ACNUC server is released. Preliminary tests suggest that working with about 100,000

Hello R developers, I am working on the "seqinr" package and I encounter a tricky problem using a C function. We defined a C fonction called "getzlibsock" which is dedicated to compressed socket connections. This function is using the R internal C function called "getConnection(int)" in order to get information about the socket previously opened with the

 Sir,  I am a student in biostat and bioinformatics.  I am interested to use R for my research work related to codon usage analysis.This software was used in a publication entitled " Online synonymous codon usage analyses with the ade4 and seqinR packages" and a weblink  http://pbil.univ-lyon1.fr/datasets/charif04/ was given for readers to use the program. Now  I would like to use the

Hi I would like to use 'write.fasta(sequences, names, nbchar = 60, file.out, open = "w")' to convert a DNA sequence in a text file to fasta format. How do I read the the text file to prepare the argument 'sequences' of the function. The DNA sequence in the text file is one line as below: ATCACACAACGACACTCACCCTGGACGCTCATC......... Thank you [[alternative HTML

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi all, I am learning R by "doing". And this is my first post. I want to use R: 1- to fetch a DNA sequence from a databank (see bellow) and 2- store it as FASTA file. The problem: neither an error is prompted nor the fasta file is created. Testing the code (see bellow), I notice that everything works until the *"write.dna" *command - which is not creating the fasta file.

Hi all, I have a sequence file (fasta format) and want to calculate the rho statistics for dinucleotide abundance value on my data.. the code which I use is (using seqinr library and current working directory) seq_info<-read.fasta("gene.txt") rho(seq_info[1],2) but it yields only the dinucleotides, not their rho values, i.e, > rho(seq_info[1],2) aa ac ag at ca cc cg ct ga gc

I suspect you meant WD <- "~/Documents/Scripting/R_Studio/Sequences/" but I am entirely unfamiliar with the packages you are using, and know nothing about what is on your hard drive. For future reference: A) Read the Posting Guide. This is a plain text email list, and your html formatting gets removed leaving a mess that is not always readable. B) Most frequent users of R

Hi - When I'm trying to read in a text file into a labeled character array, the memory stamp/footprint of R will exceed 4 gigs or more. I've seen this behavior on Mac OS X, Linux for AMD_64 and X86_64., and the R versions are 2.4, 2.4 and 2.2, respectively. So, it would seem that this is platform and R version independant. The file that I'm reading contains the upstream regions

Hi !  Facing problem with " getSequence" commend .  when only biomaRt package loaded the following example working well  >mart <- useMart("ensembl",dataset="hsapiens_gene_ensembl") >seq = getSequence(id="BRCA1", type="hgnc_symbol", seqType="peptide", mart = mart) show(seq) but when i have loaded the seqinr, i got problem

Good afternoon. I am a master student in University of Porto in Portugal. At this moment I’m starting to use R, so I have some doubts. The aim of my analysis is: calculate a pairwise FST matrix from fasta file and creat a principal component analyses with adegenet package (I use seqinr and ape package to read this file, then I convert this file into a genind object with DNA2genind function

Dear useR's I have a small basic problem which I am hoping to get some help with. I have a data frame, testSeq_df, with 1 row and 500 columns. Each column is a character (a,c,g or t). I want this sequence to have 4 factors (a,c,g,t). When I try the following: for(i in 1:500){ if (length(levels(testSeq_df[,i]))==1) levels(testSeq_df[,i]) <-

Dear R-Users, ade4TkGUI is a new package available on CRAN. It implements a Tcl/Tk graphical user interface (GUI) for the ade4 package. Only the most basic functions of ade4 have a GUI in this first version : classical one-table data analysis methods (PCA, COA, MCA, PCO, etc.), one table with groups of rows (BGA, WGA, DA), and two-tables analysis methods (Coinertia analysis, CCA, PCAIV).

Dear R-Users, ade4TkGUI is a new package available on CRAN. It implements a Tcl/Tk graphical user interface (GUI) for the ade4 package. Only the most basic functions of ade4 have a GUI in this first version : classical one-table data analysis methods (PCA, COA, MCA, PCO, etc.), one table with groups of rows (BGA, WGA, DA), and two-tables analysis methods (Coinertia analysis, CCA, PCAIV).

Hi everyone I have got a quick question: I the "seqinr" package: *dist.alignment(x,"identity")* This is calculating the square root of pairwise distances. Does anyone know whether/how gaps are counted in this function? Thank you. Best wishes, Bettina [[alternative HTML version deleted]]

Hello, I am working on an unix SunOS machine ( sun4u sparc) and since the last release of R -R version 2.5.0 (2007-04-23) - , I have got troubles during the execution of batch command. For example with the instruction file multic.in >cat multic.in install.packages("multic","/bge/penel/R_install/R_2.5.0/lib/R/library",repos="http://cran.at.r-project.org")