similar to: Game install failed

Borderlands DVD Gamespy & DLC1 not working w/ patch 1.0.1, 1.1.0 & 1.2.0 This is kind of odd. I've installed Borderlands multiple times with no problems. I've played Borderlands to the very end of the game and to Playthrough 2 without any problems. The problem I'm facing is that Borderlands does not recognise the patch. This causes the game to not work with Multiplayer under

R friends, I am using R 2.1.0 in a Win XP . I have a problem working with lists, probably I do not understand how to use them. Lets suppose that a set of patients visit a clinic once a year for 4 years on each visit a test, say 'eib' is performed with results 0 or 1 The patients do not all visit the clinic the 4 times but they missed a lot of visits. The test is considered positive if it

We're a dealer in Europe selling commercial phone & building management systems, some residential too. All the new office buildings have an EIB bus to manage the lights, clima, security access, etc. The big companies also have Crestron or AMX automation and media servers for the boardroom. Asterisk is an awesome phone solution, but if we could offer a solution that tied it all together

Does anyone know of a cross browser solution to print a page/url after a user clicks a button? Currently, I''m using a "hidden" iframe to do my bidding. But from my experience, IE requires that the iframe''s src attribute be set initially to the url, in order for the page to open properly. I wasn''t able to add the iframe to the page dynamically, either. So

I have re-labeled tick marks on the x axis. The problem is that by using axes=FALSE, the axes disappears and when they are called back using axis(side=1)..etc. the axis on sides 1 and 2 do not meet at the bottom left corner of the graph. I would also like to have the 3rd and 4th axes in there as well, all meeting in their respective corners. par(mfrow=c(1,2)) gut<-c("Full",

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

I recently upgraded from 2.41 to 2.43. I feed my Icecast server with either a live stream or from EZStream. I am now finding that track title metadata never exceeds thirty characters. Is this new, or have I got something wrong in the 2.43 configuration? I am actually using the same one I used for 2.41, and I don't ever remember seeing anything in the XML that controls length of metadata

hello, I have got some trouble with R functions nlm(), nls() or optim() : I would like to fit 3 parameters which must stay in a precise interval. For exemple with nlm() : fn<-function(p) sum((dN-estdata(p[1],p[2],p[3]))^2) out<-nlm(fn, p=c(4, 17, 5), hessian=TRUE,print.level=2) with estdata() a function which returns value to fit with dN (observed data vactor) My problem is that only

Dear all, I am new to samba. have configured a samba share, pls see config file below and my problem is that the share works successfully however to work I need to create an equivalent user locally , in the case ' boule ' . Is there a way to authenticate to the domain , force user and group as apache and having the valid users not created locally on the machine ? tnx konrad # This is

Got someone this demo working? 50,- EUR is a lot money to me so I like to play the demo first. But it seems to be impossible? I have latest Wine from GIT and did the required winetricks steps (dinput8, xinput, removed asterisk from dinput8 user.reg line, added xinput1_3 (with native only) to winecfg, corefonts, tahoma installed; all done in a new wine bottle aka. WINEPREFIX). A +d3d logfile

Hi, My company has a Samba [3.0] share on a Debian Linux 3.0 [Kernel 2.6] machine and we are trying to copy a large file [>2GB] from a Windows machine to the Samba share. When we try to do this, it only copies 2GB of the information. We were previously having a similar issue when transfering a large file [>2GB] from Linux to a Windows share [mounted as smbfs], but fixed that with the

Does anybody knows how can I display the memory usage in R? I'd like to know how much RAM R is using to store a data set that I'm reading, is it possible? Thanks in advance, Beatriz -- View this message in context: http://r.789695.n4.nabble.com/display-memory-usage-tp4175898p4175898.html Sent from the R help mailing list archive at Nabble.com.

I have a file system I am trying to resize via resize2fs but I get this error resize2fs 1.41.14 (22-Dec-2010) resize2fs: New size too large to be expressed in 32 bits im on debian squeeze 2.6.32-5-amd64 # pvs ? PV???????? VG????? Fmt? Attr PSize? PFree ? /dev/md1?? vgRAID6 lvm2 a-?? 18.17t 134.12g # lvs ? LV??? VG????? Attr?? LSize? Origin Snap%? Move Log Copy%? Convert ? data1 vgRAID6 -wi-ao

I would like to import "tif" images in R and I do not find any function that can do that. In Matlab there exists the function "imread" that can read the most known images format. Does a similar function exist for R ? Thanks in advance -- Herve CARDOT ____________________________________________________________ Unite Biometrie et Intelligence Artificielle, INRA Toulouse BP

On Fri, 10 Feb 2017 14:29:00 +0100 Patrik <alabard at gmail.com> wrote: > *Same result:* > Calling samba-tool dns for SRV _ldap._tcp.Default-First-Site-Name._ > sites.ForestDnsZones.ac.patrikx3.tk server.ac.patrikx3.tk 389 (add) > Calling samba-tool dns add -k no -P ['192.168.78.20', > 'ac.patrikx3.tk', >

Tried with a windows 2008 r2 AD master brouser is available, microsoft is migrating to what option? 2016-06-20 18:49 GMT+02:00 Trenta sis <trenta.sis at gmail.com>: > First of all, thanks for you answer. > > "Problem" is that our users are using this feature, and if we can keep > this should be the best option to ensure that our user have detecte any > difference

I'm probably misunderstanding something in "Writing R Extensions" version 1.0.0. In the chapter on the R API, section 4.7, it is stated that the functions listed in R_ext/Linpack.h are available to users' Fortran code. I am developing a developing a library of ode solvers, based on lsoda and ddassl, and which in turn call some routines from linpack and double precision blas. I

Hi Team, I have the kick start file where my root password is store like # Root password rootpw --iscrypted $1$1SItJOAg$UM9n7lRFK1/OCs./rgQtQ/ # System authorization information auth --useshadow --passalgo=sha512 Is there any way to decry pt the password and get it as plain text. I know single user mode works but my case it in remote site. Thanks, Jegadeesh

Hi, I'm migrating samba 3 nt domain (openldap + samba) to samba 4 AD, and we detected taht one of features, master browser is not working in samba 4 AD. I have searched some info and I have found: https://wiki.samba.org/index.php/FAQ " Why is Network Neighbourhood empty or does not show all machines in an Samba AD environment? The master browser code in smbd does not collect names

Hi Benno, --- Benno Senoner <sbenno@gardena.net> wrote: > Hi, sorry for writing you directly, It's no trouble, though you may get more or better advice posting to one of the mailing lists or on irc (#winehq). I'm cc'ing wine-users in case someone else has experience in this area, hope you don't mind. > assume I use LabView on Windows to make a standalone .exe >