similar to: readLines on open connection reads only first write on MacOS

Thank you for your suggestion. Unfortunately, while R doesn't segfault calling readr::read_file() on the test file I described, I get the error message: Error in read_file_(ds, locale) : negative length vectors are not allowed Jen On Sat, Sep 2, 2017 at 1:38 PM, Ista Zahn <istazahn at gmail.com> wrote: > As s work-around I suggest readr::read_file. > > --Ista > > >

Hi: I have a 2.1GB JSON file. Typically I use readLines() and jsonlite:fromJSON() to extract data from a JSON file. When I try and read in this file using readLines() R segfaults. I believe the two salient issues with this file are 1). Its size 2). It is a single line (no line breaks) I can reproduce this issue as follows #Generate a big file with no line breaks # In R >

As s work-around I suggest readr::read_file. --Ista On Sep 2, 2017 2:58 PM, "Jennifer Lyon" <jennifer.s.lyon at gmail.com> wrote: > Hi: > > I have a 2.1GB JSON file. Typically I use readLines() and > jsonlite:fromJSON() to extract data from a JSON file. > > When I try and read in this file using readLines() R segfaults. > > I believe the two salient

Although the problem can apparently be avoided in this case. readLines causing a segfault still seems unwanted behaviour to me. I can replicate this with the example below (sessionInfo is further down): # Generate an example file l <- paste0(sample(c(letters, LETTERS), 1E6, replace = TRUE), collapse="") con <- file("test.txt", "wt") for (i in

Jeroen: Thank you for pointing me to ndjson, which I had not heard of and is exactly my case. My experience: jsonlite::stream_in - segfaults ndjson::stream_in - my fault, I am running Ubuntu 14.04 and it is too old so it won't compile the package corpus::read_ndjson - works!!! Of course it does a different simplification than jsonlite::fromJSON, so I have to change some code, but

Helper functions for future support of backslash escaped spaces in filenames. There are a few tests too. Changed according to review remarks and fixed few other mistakes. Maros Zatko (4): fish: copy parse_quoted_string and hexdigit from fish.h to rl.c fish: rl.{c,h} - escaping functions for readline fish: basic tests for readline escaping autotools: add fish/test Makefile.am

From: Maros Zatko <mzatko@redhat.com> Helper functions for future support of backslash escaped spaces in filenames. There are a few tests too. Changed according to review remarks. Maros Zatko (3): fish: rl.{c, h} - escaping functions for readline fish: basic tests for readline escaping autotools: add fish/test Makefile.am | 1 + configure.ac | 1 +

From: Maros Zatko <hacxman@gmail.com> Auxiliary functions for readline to support space character escaping in filenames in future. Escaping function is taken from fish.c (used to be parse_quoted_string) plus its un-escaping counterpart. There are a few tests for both. Maros Zatko (3): fish: rl.{c,h} - escaping functions for readline fish: basic tests for readline escaping autotools:

Hi, I am reading a large space-delimited text file into R (41 columns and many rows) and need to do run each row's values through another R object and then write to another text file. So, far using readLines and writeLines seems to be the best bet. I've gotten the data exchange working except each row is read in as one 'chunk', meaning the row has all values between two quotes

Hello, The diffs below are based on revision 37445 and show some typo corrections for writeLines.Rd, readLines.Rd, and data.matrix.Rd that I'd like to bring to the list's attention. Sincerely, Stephen Weigand Rochester, Minnesota, USA --- ./src/library/base/man/writeLines.Rd Sun Feb 26 13:46:06 2006 +++ /tmp/writeLines.Rd Sun Feb 26 20:53:44 2006 @@ -14,8 +14,8 @@ each

Hello, I'm seeing a nuisance warning when I run `R CMD check --as-cran whatever_x.y.z.tar.gz`. I generally work with these options set: options( warnPartialMatchArgs = TRUE, warnPartialMatchAttr = TRUE, warnPartialMatchDollar = TRUE ) And I see this: * checking use of SHLIB_OPENMP_*FLAGS in Makefiles ...Warning in dir("src", patt = "[.]c$") : partial argument

Hello * I would like to reshape wide the following dataset: > rl <- read.dta("intermedi/rapporti_lavoro.dta") [c("id_rl","prog","sil_pi","sil_cf","sil_dat_avv")] > dim(rl) [1] 12964 5 > object.size(rl) 1194728 bytes > head(rl) id_rl prog sil_pi sil_cf sil_dat_avv 1 638 1 04567XXXXXX

I have been through the help file archives a number of times, and still cannot figure out what is wrong. I have a tab-delimited text file. 76Mb, so while it's large.. it's not -that- large. I'm running Win7 x64 w/4G RAM and R 2.10.1 When I open this data in Excel, i have 27 rows and 450932 rows, excluding the first row containing variable names. I am trying to get this into R as a

I'm using functions to return a matrix of all permutations of a specified size from a larger list for predictor selection. For each predictor size I use a seperate function like this: bag2 <- function(n) { rl <- c() for (i1 in seq(n)) { for (i2 in seq(n)) { if (length(unique(c(i1,i2)))==1) {next} rl <- cbind(rl,matrix(c(i1,i2))) } }

I was told to re-raise this issue with R-dev: In the documentation of R-dev and R-3.4.3, under ?gsub > replacement > ... For perl = TRUE only, it can also contain "\U" or "\L" to convert the rest of the replacement to upper or lower case and "\E" to end case conversion. However, the following code runs differently: tempf <- tempfile()

Working on Windows I have had to deal with CSV files that, unfortunately, contain embedded Control-Zs, i.e. ASCII character 26 in decimal, and the readLines() function in R on Windows (2.15.2 and 3.0.0) appears to truncate at the control-Z. There is no problem at all on Ubuntu Linux with R 3.0.0. Am I mistaken or is this genuine? # Create a small file with embedded Control-Z h3 <-

I think the problem in R-devel happens when there are non-ASCII characters in any of the strings passed to gsub. txt <- vapply(list(as.raw(c(0x41, 0x6d, 0xc3, 0xa9, 0x6c, 0x69, 0x65)), as.raw(c(0x41, 0x6d, 0x65, 0x6c, 0x69, 0x61))), rawToChar, "") txt #[1] "Am?lie" "Amelia" Encoding(txt) #[1] "unknown" "unknown" gsub(perl=TRUE,

| Confirmed for R-devel (current) on Ubuntu 17.10. But ... isn't the regexp | you use wrong, ie isn't R-devel giving the correct answer? No, I don't think R-devel is correct (or at least consistent with the documentation). My interpretation of gsub("(\\w)", "\\U\\1", entry, perl = TRUE) is "Take every word character and replace it with itself, converted to

Hi all, I searched through the archives, but couldn't find a fix... Basically, I've got a bunch of numeric vectors and one character vector that I want to bind into a data frame. When I include the character vector as a column in the data frame, all the numeric columns get factored in the data frame, which makes it tough to call those columns for calculations later on. I've tried

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789