similar to: imap process consuming 100% CPU (Dovecot 1.0.3)

Hi, I am getting the following error in the server mail logfile: > Sep 2 18:39:44 h648123 dovecot: IMAP(<account>)(<PID>): Disconnected: BUG: Unknown internal error (mail_debug is on, but there is not really much context for this in the log file, ie. no log events for several minutes, and then it appears, all of a sudden). On the client side, it looks like this (with some

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

To some users happens this assertion failure while deleting a message. dovecot: Mar 10 08:40:44 Panic: IMAP(user): file index-sync.c: line 39 (index_mailbox_set_recent_uid): assertion failed: (seq_range_exists (&ibox->recent_flags, uid)) dovecot: Mar 10 08:40:44 Error: IMAP(user): Raw backtrace: [see bleow] dovecot: Mar 10 08:40:44 Error: child 17683 (imap) killed with signal 6 And the

Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22

http://dovecot.org/releases/2.2/dovecot-2.2.16.tar.gz http://dovecot.org/releases/2.2/dovecot-2.2.16.tar.gz.sig A few fixes and some imapc improvements since the release candidate. * dbox: Resyncing (e.g. doveadm force-resync) no longer deletes dovecot.index.cache file. The cache file was rarely the problem so this just caused unnecessary slowness. * Mailbox name limits changed during

http://dovecot.org/releases/2.2/dovecot-2.2.16.tar.gz http://dovecot.org/releases/2.2/dovecot-2.2.16.tar.gz.sig A few fixes and some imapc improvements since the release candidate. * dbox: Resyncing (e.g. doveadm force-resync) no longer deletes dovecot.index.cache file. The cache file was rarely the problem so this just caused unnecessary slowness. * Mailbox name limits changed during

> > Is this behavior cured, or do you continue to see it? > No, the behavior isn't cured. We still continue to see it with various clients. I have posted a couple of truss outputs, but so far no resolution. Sorry for the slow response. I've been "fighting other fires". Jackie > Jackie Hunt wrote: > >> On Mon, 2007-09-03 at 12:37 +0200, Robert

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes

Two simple build fixes for libldm. Well, the first isn't a build fix as such, but a code improvement. Rich.

Hi, after upgrade to Dovecot >= 2.2.14rc1 sometimes I found this error/crash in the log (never happened with 2.2.13), I'm the only one? Can be fix? Nov 11 17:44:26 imap(info at myemail.com): Error: Corrupted transaction log file /home/domains/myemail.com/info/Maildir/dovecot.index.log seq 190: Invalid transaction log size (32756 vs 32772):

Below is code that introduces a list comprehension syntax into R, allowing expressions like: > .[ sin(x) ~ x <- (0:11)/11 ] [1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397 [7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098 > .[ .[x*y ~ x <- 0:3] ~ y <- 0:4] [,1] [,2] [,3] [,4] [,5] [1,] 0 0 0 0 0 [2,] 0 1 2