similar to: exim/kmail vs. dovecot

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

I am wanting to plot a 95% confidence band using segplot, yet I am wanting to have groups. For example if I have males and females, and then I have them in different races, I want the racial groups in different panels. I have this minor code, completely made up but gets at what I am wanting, 4 random samples and 4 samples of confidence, I know how to get A & B into one panel and C&D in to

Below is code that introduces a list comprehension syntax into R, allowing expressions like: > .[ sin(x) ~ x <- (0:11)/11 ] [1] 0.00000000 0.09078392 0.18081808 0.26935891 0.35567516 0.43905397 [7] 0.51880673 0.59427479 0.66483486 0.72990422 0.78894546 0.84147098 > .[ .[x*y ~ x <- 0:3] ~ y <- 0:4] [,1] [,2] [,3] [,4] [,5] [1,] 0 0 0 0 0 [2,] 0 1 2

Hello Julien, Am Tue, 15 Jan 2019 09:30:23 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > In that case I see: > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq1, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq2, length 64 > IP 172.16.0.3 > 192.168.1.1: ICMP echo request, id2135, seq3, length 64 > > Packet goes

Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22

Hello all, I have the code below to simulate samples of certain size from a particular distribution (here,beta distribution) and compute some statistics for the samples. betasim2<-function(nsim,n,alpha,beta) { sim<-matrix(rbeta(nsim*n,alpha,beta),ncol=n) xmean<-apply(sim,1,mean) xvar<-apply(sim,1,var) xmedian<-apply(sim,1,median)

Hi, I am using package deSolve to run some ordinary differential equations (ODE) as part of a mathematical modeling project. I have solved for the following equilibrium states: Seq1<-a*(1-Neq1)/(f*Veq1+m+d) Ceq1<-(f*Seq1*Veq1+g*Ieq1+r*(1-Neq1)-b1*Veq1*Ieq1)/(b2+m+d+g) Ieq1<-(-b2*Ceq1)-r*(1-Neq1)/(b1*Veq1-g-u) Veq1<-o*(Ceq1+Ieq1)/e I want to take the differential of both sides of

Worse now: I get stuff such as http://paste.debian.net/44248 in my log. What is dovecot trying to do and why? Kris -- Kristian =?iso-8859-15?q?K=F6hntopp?= <kris at xn--khntopp-90a.de>

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

Dear R experts, I have two matrix (seq & mat) & I want to retrieve in a new matrix all the numbers from mat that =1 (corresponding to the same row/ column position) in seq, or all the numbers in mat that =-1 in seq. - Replace all the numbers with NA if it's not 1/-1 in seq. There are some "NA"s in seq. seq=matrix(c(1,-1,0,1,1,-1,0,0,-1,1,1,NA),3,4)

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

Le mar. 15 janv. 2019 à 03:13, Lars Kruse <lists at sumpfralle.de> a écrit : > Hello Julien, > > > Am Mon, 14 Jan 2019 22:15:47 +0100 > schrieb Julien dupont <marcelvierzon at gmail.com>: > > > > ** Test 1 ** > > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > > When pinging 192.168.1.1 from client 1, with no success, I

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

On Thu, 2018-06-07 at 10:26 -0700, Nick Desaulniers wrote: > I get the feeling that the use of __inline__ or __inline (vs inline) > in the kernel may be wrong and their use should be eradicated in the > follow up patch set, but it would be cool if others have additional > insight. __inline is easy and useful to remove as it's used in just a few files. But __inline__ is used in a