Displaying 20 results from an estimated 5000 matches similar to: "Debugging password schemes"
2011 Mar 29
2
Trouble with password scheme module
Hi, all.
About two and a half years ago, I wrote a hack to add an additional
MD5-based password scheme to Dovecot, but I wrote it as a hack to
src/auth/password_scheme.c since it was relatively easy to do, and I
needed to get a machine running since the machine I was replacing, a Sun
Ultra 5 running Post.Office, had dying hard drives.
Now, I'm actually sitting down and adapting it as a
2008 Sep 22
1
Adding new password schemes?
Hi, all.
I was curious how difficult it would be to add a new password scheme to
Dovecot? I have to transplant mailboxes from one machine to another,
the older machine running Post.Office from now-defunct Software.Com,
which was bought by OpenWave, then discontinued. Apparently, Netscape's
mailserver offering from the day also supports this scheme. There's
code out there that was
2008 Oct 11
1
Password scheme module thoughts?
Hi, all.
I have successfully deployed the code I wrote to handle Post.Office
password hashes. However, I had to implement it as a hack to
password-scheme.c. I'd like to implement it as a module so I don't have
to hack Dovecot whenever a new release comes out. However, I had a few
thoughts:
1. I used Dovecot's own MD5 routines in my implementation because I
know how they
2000 May 14
0
OpenSSH 2.1.0+OpenSSL 0.9.5a+RSAref 2.0 trouble
Hello.
I have been having trouble configuring the source code for the
abovementioned. I have to use RSARef as I'm a resident of the USA, so I
can avoid patent violation.
The configure script fails to see the OpenSSL+RSAref mix on three
different platforms, including the following:
FreeBSD 4.0-STABLE (Which has its own port, but I wanted to try it there
to see if I could reliably reproduce
2009 Jul 30
2
Any more details on Lance? (just curious; no pressure)
A friend of mine sent me this link:
http://linux.slashdot.org/story/09/07/30/130249/CentOS-Project-Administrator-Goes-AWOL
I went to the main page and read the letter and the "Facts." Are
there any more details, mainly along the lines of CentOS sticking
around - I know you folks all work really hard on this, and you know
better than me how many others depend on you - but - there's
2015 May 26
5
New controller card issues
Running CentOS 5 (long story, will be updated some day). A 5 yr old Dell
PE R415. Whoever spec'd the order, they got the cheapest, embedded
controller. Push came to shove - these things gag on a drive > 2TB. So, we
bought some PERC H200's for it, and its two mates. This morning, I brought
the system down, and put in the card, and moved the SATA cables.
This did not end well.
The new
2004 Oct 05
2
ldap SMD5 vs. CRYPT
Hello,
am I right, that dovecot can't cope with ldap so authentification
is handled by ldap itself? And, for that I have to use {CRYPT} and
cannot use other mechanisms as {SMD5}
Are there any other possibilities?
A
--
2004 Sep 23
5
Billing Fun - anybody know where to get a NPA/NXX db?
Hello;
I've been playing with a nifty Open Source java based report writer
called Datavision (datavision.sourceforge.net) and I've managed to write
enough logic to calculate phone bills at different rates from the MySQL
cdr's. (cdr_addon_mysql) Eventually I want to have sets of rate
structures for each user of the system - so I can bill client A at 3
cents a minute and client B at 2
2018 Jun 08
2
C7, encryption, and clevis
Valeri Galtsev wrote:
>
>
> On 06/08/18 10:27, m.roth at 5-cent.us wrote:
>> John Hodrien wrote:
>>> On Fri, 8 Jun 2018, m.roth at 5-cent.us wrote:
>>>
>>>> We've been required to encrypt h/ds, and so have been rolling that out
>>>> over the last year or so. Thing is, you need to put in a password, of
>>>> course, to boot the
2013 Mar 21
1
dhcpd options
A few weeks ago, suddenly, reading news at lunch, I could not get to
nytimes.com. I could ping it, and nslookup it, and if I put the IP address
in place of the name, it was fine.
After *much* back and forth over a ticket I put in, over the last week or
so, our group figured it out: It *seemed* to be related to IPv6, and
there's only *some* few sites, such as the Times, and Orbits, and one or
2007 Feb 20
0
Uninstalling GAG Boot Manager
Dear friends:
New to Centos, DVD version 4.4. Fabulous distro, rich in features,
applications, very stable and robust.
My first install failed to boot up (after rebooting, switching in Bios from
CD/DVD to hard drive. This was probably because I chose to install the Grub
boot loader in MBR. I got the error message:
GRUB, Stage 2
Loading...
But it never loaded up. Nothing happened.
So, I
2015 May 28
3
New controller card issues
On Thu, May 28, 2015 10:46 am, Kirk Bocek wrote:
>
>
> On 5/26/2015 11:07 AM, m.roth at 5-cent.us wrote:
>> Push came to shove - these things gag on a drive > 2TB.
>
> I ran into this a couple of years ago with some older 3Ware cards. A
> firmware update fixed it.
>
With 3ware cards depending on card model:
1. the card supports drives > 2TB
2. the card as
2007 May 30
1
Dovecot support for smd5 and ldap-md5
Working with a dovecot migration, I am curious what version (if any)
of Dovecot (dovecot-auth) supports SMD5 and ldap-MD5 when using
Dovecot -> OpenLDAP direct binding?
Thank you!
Eric
2023 Feb 22
1
Auth-worker, unknown scheme ARGON2ID
On 21 Feb 2023, at 10:12 pm, James Brown <jlbrown at bordo.com.au> wrote:
>
> The new one has Dovecot compiled with same configure options, same configuration files, but fails to authenticate:
>
> Feb 21 21:51:03 master: Info: Dovecot v2.3.20 (80a5ac675d) starting up for imap, pop3 (core dumps disabled)
> Feb 21 21:51:33 auth-worker(11701): Error: conn unix:auth-worker
2016 May 18
4
enlarging partition and its filesystem
Hi all!
I've got a VM at work running C6 on HyperV (no, its not my fault,
that's what the company uses. I'd rather gag myself than own one
of th ose things.)
I ran out of disk space in the VM, so the admin enlarged the virtual disk.
but now I realize I don't know how to enlarge the partition and its
filesystem.
I'll be googling, but in case I miss it, it'd be great if
2007 Apr 12
1
Dual boot problem with XP and CentOS4.4
Hi
i am using CentOS 4.4 version individually. working very fine. but,
when i try to install CentOS4.4 as a dual boot with windows XP, i couldn't
install. its taking so much of time to show the installation screen. i have
given my hardware configuration below,
Intel Dual Core 2.8 Ghz
Intel D945GCCR MotherBoard
1GB DDR Ram
80GB SATA HDD (western digital)
this is the first time i am trying
2020 Mar 17
3
Headsup on feature removal - password
> Password schemes: HMAC-MD5, RPA, SKEY, PLAIN-MD4, LANMAN, NTLM, SMD5
The web is flooded with plain text passwords and hashed passwords harvested from hacked servers.
Dovecot stores passwords with the same scheme used for client authentication.
Therefore, we use crammd5/hmac-md5. It does not look like much, but is better than plaintext.
As md5 is about to go, and I have no intention to
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2007 Feb 07
1
PLAIN-MD5 password scheme with salt?
Hello!
I'm storing passwords as MD5 hashes in a MySQL database and have
specified "default_pass_scheme = PLAIN-MD5" in dovecot-sql.conf.
Can Dovecot append or prepend a salt to a password before hashing them?
Because without salt the plaintext passwords can be restored from the
MD5 hashes using rainbow tables.
Greetings
Steffen Weber
2018 Dec 03
2
dovecot and argon2 encryption
I am using a FreeBSD 11-2 amd/64 system with dovecot version 2.3.4 installed.
I was playing around with different encryption schemes.
doveadm pw -l
SHA1 SSHA512 BLF-CRYPT PLAIN HMAC-MD5 OTP SHA512 SHA RPA DES-CRYPT CRYPT SSHA
MD5-CRYPT SKEY PLAIN-MD4 PLAIN-MD5 SCRAM-SHA-1 LANMAN SHA512-CRYPT CLEAR
CLEARTEXT SSHA256 NTLM MD5 PBKDF2 SHA256 CRAM-MD5 PLAIN-TRUNC SHA256-CRYPT
SMD5 DIGEST-MD5