Displaying 20 results from an estimated 300 matches similar to: "[ANNOUNCE] xf86-video-tga 1.2.0"
2023 Jul 04
1
Found multiple results for "tga":
I only have a tga user. But it says it has multiple entries.
( ERROR: Failed to add members ['tga'] to group "backup" - Found
multiple results for "tga": )
root at dc0:~# samba-tool group list |grep backup
lpcfg_do_global_parameter: WARNING: The "domain logons" option is
deprecated
ldb_wrap open of secrets.ldb
backup
root at dc0:~# samba-tool user
2023 Jul 04
1
Found multiple results for "tga":
On 04/07/2023 17:14, Edson Wolf via samba wrote:
> I only have a tga user. But it says it has multiple entries.
>
> ( ERROR: Failed to add members ['tga'] to group "backup" - Found
> multiple results for "tga": )
>
> root at dc0:~# samba-tool group list |grep backup
> lpcfg_do_global_parameter: WARNING: The "domain logons" option is
2008 Dec 22
0
[ANNOUNCE] xf86-video-ark 0.7.1
Adam Jackson (1):
Uninclude xf86Version.h
Dave Airlie (1):
ark 0.7.1
git tag: xf86-video-ark-0.7.1
http://xorg.freedesktop.org/archive/individual/driver/xf86-video-ark-0.7.1.tar.bz2
MD5: be91391f061863617018403cdbd2944f xf86-video-ark-0.7.1.tar.bz2
SHA1: d2e929cddda2e5f2df87a1ef53db585bcedb0c59 xf86-video-ark-0.7.1.tar.bz2
2008 Mar 06
0
[ANNOUNCE] xorg-server 1.4.99.901
Aaron Plattner (11):
Bug #12015: Use the right offsets in the dst arguments of pixman_blt.
stride is in FbBits-sized chunks, but xoff is not.
Bump video driver ABI for pci-rework.
Set noCompositeExtension to TRUE when failing to initialize the extension (e.g. when Xinerama is enabled).
Don't segfault on shutdown if we never managed to connect to dbus.
2011 Nov 08
0
Sound shuts off when going past the main menu in MGS1
I've got Metal Gear Solid running fairly smoothly in Wine 1.3.31 on Mac OSX Snow Leopard, with no instability or crashes so far. When I start the game, the sound acts as it should-- however, going past the main menu (such as to Briefing or New Game) causes the sound to stop working. How can this issue be fixed?
Here's my console output:
Code:
2008 Mar 06
0
[ANNOUNCE] printproto 1.0.4
Alan Coopersmith (1):
renamed: .cvsignore -> .gitignore
Eamon Walsh (2):
Updates to printproto as part of devPrivates rework.
Update package version number for devPrivates rework.
Egbert Eich (1):
23. Merged with XFree86 4.4.0. Added changes that went into infected files.
James Cloos (2):
Add *~ to .gitignore to skip patch/emacs droppings
Replace static
2010 Oct 29
0
Wine release 1.3.6
The Wine development release 1.3.6 is now available.
What's new in this release (see below for details):
- Support for GStreamer filters.
- Mapping of standard cursors to native desktop cursors.
- Improved support for installers with services.
- Many MSXML improvements.
- Decoder for TGA-format images.
- Translation updates.
- Various bug fixes.
The source is available from the
2010 Jun 12
1
Problem launching Cursed mountain
Hello
I installed the game "Cursed Mountain", with no problems, at the end of the installation it asked for launching the game, and the game ran successfully. Later I wanted to launch it again, but now it gets stuck after the logo intro.
The terminal output is:
Code:
---------------------------------------------------
KTM
---------------------------------------------------
Version:
2009 Feb 24
0
[ANNOUNCE] xf86-input-aiptek 1.2.0
Aiptek 1.2.0.
Alan Coopersmith (2):
Remove xorgconfig & xorgcfg from See Also list in man page
Add README with pointers to mailing list, bugzilla & git repos
Julien Cristau (1):
Link against -lm for sqrt()
Paulo Cesar Pereira de Andrade (1):
Janitor: rework make distcheck
Peter Hutterer (3):
Check for XINPUT ABI 3.
Fix build, xf86Version.h has been
2001 Jan 10
3
Video compression, edge detection, and gcc warnings
<WARNING: Long message ahead>
Well, I have actually done something the past 1 1/2 week. I've created a
program that runs several filters over an image to extract edge
information. Currently it loads any uncompressed grayscale TGA file, and
spits out another uncompressed greyscale TGA file that is 255 at places
where there are edges, and 0 where there are not. I managed to get out
quite
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
1999 Jun 17
0
Forw: [RHSA-1999:013-01] New XFree86 packages for Red Hat Linux 6.0
------- Forwarded Message
Return-Path: redhat-watch-list-request@redhat.com
Received: from lists.redhat.com (lists.redhat.com [199.183.24.247])
by sapphire.fnal.gov (8.8.7/8.8.7) with SMTP id VAA26469
for <yocum@sapphire.fnal.gov>; Wed, 16 Jun 1999 21:19:18 -0500
Received: (qmail 7754 invoked by uid 501); 17 Jun 1999 03:06:01 -0000
Resent-Date: 17 Jun 1999 03:06:01 -0000
Resent-Cc:
1999 Jun 17
0
Forw: [RHSA-1999:013-02] New XFree86 packages (updated)
below.
Dan
___________________________________________________________________________
Dan Yocum | Phone: (630) 840-8525
Linux/Unix System Administrator | Fax: (630) 840-6345
Computing Division OSS/FSS | email: yocum@fnal.gov .~. L
Fermi National Accelerator Lab | WWW: www-oss.fnal.gov/~yocum/ /V\ I
P.O. Box 500 |
2015 Sep 04
0
Login "error" message
Dear Community
I have been receiving the below each time when I log into one of my servers using ssh.
declare -x G_BROKEN_FILENAMES="1"
declare -x HISTCONTROL="ignoredups"
declare -x HISTSIZE="1000"
declare -x HOME="/home/xxxx"
declare -x HOSTNAME="CentOS-66-64-minimal"
declare -x LANG="en_US.UTF-8"
declare -x
2006 Feb 15
0
setup program doesn't find extracted dll
Hello to all,
i'm trying to install the german tax software "Tax@2006".
using: wine 0.9.5 on ubuntu 5.10
I type "wine z:/setup.exe" (z = wine's dos-device cdrom).
the follonwing steps follows:
- Splash Screen "Buhl Data"
- Installshield preparing installation...
- Installshield starts, but brings a Popup:
- Message: "Failed to extract
2011 Jul 19
1
Re: Problem with Windows app accessing internet
OK, here's the diff file:
Code:
--- environment.before.reboot.txt 2011-07-19 17:43:58.200205228 +0100
+++ environment.after.reboot.txt 2011-07-19 17:53:07.549616184 +0100
@@ -1,16 +1,16 @@
ORBIT_SOCKETDIR=/tmp/orbit-charlie
-SSH_AGENT_PID=2912
+SSH_AGENT_PID=2337
TERM=xterm
SHELL=/bin/bash
-XDG_SESSION_COOKIE=2dd5655fe15f1c42f474dd204c45c6b6-1311075950.779608-828425652
2012 Oct 29
3
[Bug 56546] New: crash at the second render when applying gamma correction
https://bugs.freedesktop.org/show_bug.cgi?id=56546
Priority: medium
Bug ID: 56546
Assignee: nouveau at lists.freedesktop.org
Summary: crash at the second render when applying gamma
correction
Severity: critical
Classification: Unclassified
OS: Linux (All)
Reporter: yves at 3delight.com
2008 Mar 02
1
Wrong uptodate
Dear list,
I am syncing files with rsync .... surprise surprise ...
Rsync claims files to be uptudate, but they are not ...
>From the log:
export/opt/bup/status/1 is uptodate
export/opt/bup/status/2 is uptodate
.
.
Source directory (locally on server):
-rw-r--r-- 1 root root 28 2008-03-01 22:44 1
-rw-r--r-- 1 root root 28 2008-03-01 22:37 2
.
.
Destination directory (nfs share):
2005 Nov 30
3
wcmd crashes all the time on the set command.
Below is a crash I get on my gentoo box when I execute
the set command in wcmd. I believe the problem is
caused by wine using the entire enviornment from my
linux machine:
john@jmd0 ~ $ wcmd
WCMD Version 0.17
W:\home\john>set
ALLUSERPROFILE=c:\windows\Profiles\Administrator
ALLUSERSPROFILE=c:\windows\Profiles\Administrator
ANT_HOME=/usr/share/ant-core
CLASSPATH=.
COLORTERM=
2002 Dec 19
0
Failed to delete entry for share
Hi All,
I'm having some minor trouble with an obscure samba feature. I'm using
the remote administration "Server Manager" features of smb.conf.
Specifically the "add share command" "change share command" and "delete
share command". I've written a small C program to do the text-processing
portion of smb.conf file needed for each operation. The C