Displaying 20 results from an estimated 900 matches similar to: "Icecast with WinAmp as a stramer"
2004 Aug 06
0
Icecast with WinAmp as a stramer
If you are using Icecast2(I think this might apply to Icecast 1.x.x but
not sure) then you need to specify a mount point for the stream.
Example: if your mountpoint is /my_super_cool_great_stream.ogg then
you would need to tell winamp to connect to
icecast_server:8000/my_super_cool_stream.ogg If you are using the
Oddcast DSP(version 1 for Winamp 2.x.x) as the source there is a text
box in
2003 Jan 02
1
icecast with winAmp as the streamer
All Icecast head.
I agree oddcast DSP plugin is more steady with Icecast. But I encounter bad passwork. I have specified the encoder password in the icecast.conf which match the plugin password. But it still didn't work. Where else to specify, and how ?. What about group.aut, mount.aut and users.aut. ?. Example ?..
---
CONFIDENTIALITY NOTICE & DISCLAIMER
This message and
2003 Jan 02
1
icecast with winAmp as the streamer
All Icecast head.
I agree oddcast DSP plugin is more steady with Icecast. But I encounter bad passwork. I have specified the encoder password in the icecast.conf which match the plugin password. But it still didn't work. Where else to specify, and how ?. What about group.aut, mount.aut and users.aut. ?. Example ?..
---
CONFIDENTIALITY NOTICE & DISCLAIMER
This message and
2012 Jun 25
2
setdiff datframes
hi,
I have 2 files example 1 and example 2 and would like to know what is in
example2 and not in example1 (attached)
V1 contain data which could be in duplicated which I am using as identifiers
I used setdiff(example2$V1,example1$V1) to find the identifiers which
are specific to example2:
[1] "rs2276598" "rs17253672"
I am looking for a way to get an output with all
2005 Jul 29
2
Amavis on centos
I already have installed, postfix, squirrelmail, dovecot, spamassassin and
clamav.
The only thinks that I missed up is some interface between clamav ,
spamassassing and postfix, I am trying with amavis-new but I gat this error
when I try to install amavis from the tar file.
ERROR: MISSING REQUIRED BASIC MODULES:
IO::Wrap
IO::Stringy
Unix::Syslog
Mail::Field
Mail::Address
2010 Sep 20
3
Program looking for dll's
Hello,
I installed wine on ubuntu 10.04. I then installed Emsisoft Anti-Malware. When I go to run it I gat the following error.
david at david-ubuntu:~/.wine/drive_c/Program Files/Emsisoft Anti-Malware$ wine a2cmd.exe
fixme:reg:GetNativeSystemInfo (0x33fc6c) using GetSystemInfo()
fixme:service:QueryServiceObjectSecurity 0x13b768 4 0x1e2e8ec 0 0x1e2e8d8 - semi-stub
2008 Feb 12
3
regular expression for na.strings / read.table
Dear all,
I am working with a csv file.
Some data of the file are not valid and they are marked with a star '*'.
For example : *789.
I have attached with this email a example file (test.txt) that looks like
the data I have to work with.
I see 2 possibilities ..thast I cannot manage anyway in R:
1-first & easiest solution:
Read the data with read.csv in R, and define as na strings
2008 May 30
1
cannot use liberty office/terp office
I was downloading offices from sourceforge.net to test on Wine and to see if I liked one better that the ones that I was using now. Liberty Office launches then says that there is no parent window.
Terp office prints this in the console log.
Modules:
Module Address Debug info Name (11 modules)
PE 400000- 44e000 Export terp
PE 60b50000-60b54000 Deferred advapi32
PE
2005 Jul 29
1
amavis again
I am progressing with this but i still gat a problem.
. When I get to the step when I am supposed to install amavisd , I get the
following error message: Can't locate BerkeleyDB.pm in @INC (@INC contains:
/System/Library/Perl//darwin-2level /System/Library/Perl/
/Library/Perl//darwin-2level /Library/Perl/ /Library/Perl/
/Network/Library/Perl//darwin-2level /Network/Library/Perl/
2006 Aug 04
3
Help with short time series
Dear R-list,
I have a statistical problem with the comparison of two short time-series of
density data in an ecological framework. I have to compare two short time
series (5 years, one value for each year) of species density data (it is the
density of fish in two different streams) to test if the two means of the
five densities are significantly different, so basically if the two mean
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2017 Oct 25
2
'check password script' and Join...
Mandi! Andrew Bartlett via samba
In chel di` si favelave...
> Thanks for asking for clarification, I hope this puts you at ease.
Sure! Thanks to you!
Only a bit more:
> > PS: and domain members? How they enforce passwords policies? Directly
> > on AD DC, i suppose... but i'll ask. ;-)
> They don't ask the DC for the choice of local user passwords as far as
>
2002 Oct 16
1
Error on startup
Hello,
could someone help me with this thing ?
gat@gat:~$wine /win/Programmi/WinMX/WinMX.exe
When you are running with a native NT directory specify
'Profile=<profiledirectory>' or disable loading of Windows
registry (LoadWindowsRegistryFiles=N)
fixme:ole:CoRegisterMessageFilter stub
fixme:ole:CoRegisterMessageFilter stub
gat@gat:~$
The last line of .wine/config contains:
2003 Jan 02
0
icecast with WinAmp as the streamer
Icecast Heads
I have tried all sorts of recomendation from the group and still can't even connect my streamer to the icecast server. I keep on receiving Bad Password. I down to the compatibility issue here. I run Icecast version 1.3.11 on the OpenBsd 3.0 and WinAmp 2.81 Streamer with oddcastDSP plug-ins. Anybody have tried these please SOUT !.
<p>saiful at sapura.com.my
Engineer at
2003 Jan 02
0
icecast with WinAmp as the streamer
Icecast Heads
I have tried all sorts of recomendation from the group and still can't even connect my streamer to the icecast server. I keep on receiving Bad Password. I down to the compatibility issue here. I run Icecast version 1.3.11 on the OpenBsd 3.0 and WinAmp 2.81 Streamer with oddcastDSP plug-ins. Anybody have tried these please SOUT !.
<p>saiful at sapura.com.my
Engineer at
2004 Aug 06
1
icecast with WinAmp as streamer.
Saiful Azian <saiful@sapura.com.my> said:
>
> I used WinAmp as a streamer to Icecsat server. I received "stupid header"
error message whenever i try to connect Winamp streamer to the Icecast server.
I was lookin for the doc to explain thsi..none. Pls help.
>
Have you got shoutcast plugin installed?
If yes, then in the field that you declare the port where you want
2018 Nov 01
3
compile Icecast 2.4.4 with Open SSL?
How do I compile Icecast 2.4.4 with openssl support?
2004 Aug 06
0
icecast with WinAmp as streamer.
I used WinAmp as a streamer to Icecsat server. I received "stupid header" error message whenever i try to connect Winamp streamer to the Icecast server. I was lookin for the doc to explain thsi..none. Pls help.
<p><p>
---
CONFIDENTIALITY NOTICE & DISCLAIMER
This message and any attachments are solely intended for the addressee(s). It may also be Sapura
2020 Feb 22
3
Cannot update xiph repository
Hi,
I apologise for the naiveness of this question, but I experienced an error when running apt-get update on Debian 9.
It’s telling me that it can’t update the xiph repository.
Not sure if I should be asking for help about this here, but if not… please let me know where I should take this issue.
Any help is appreciated.
Damian
Get:1 http://security.debian.org/debian-security stretch/updates
2018 Nov 02
2
compile Icecast 2.4.4 with Open SSL?
On Fri, Nov 02, 2018 at 11:46:52AM +0000, Thomas B. Rücker wrote:
> Usually that question comes from Ubuntu or Debian users.
> In which case we recommend:
> https://wiki.xiph.org/Icecast_Server/Installing_latest_version_(official_Xiph_repositories)
> Those official Xiph.org packages are built against openSSL.
Could someone kick the build process, please?
2.4.2-2 is the latest