similar to: [PATCH 04/45] gpu: drm: remove duplicate includes

http://bugzilla.mindrot.org/show_bug.cgi?id=249 Summary: open /dev/tty failed Product: Portable OpenSSH Version: -current Platform: UltraSparc OS/Version: Solaris Status: NEW Severity: critical Priority: P2 Component: sshd AssignedTo: openssh-unix-dev at mindrot.org ReportedBy: sam at

Broken up for Daniel Vetter Joe Perches (3): gpu: drm: amd/radeon: Convert printk(KERN_<LEVEL> to pr_<level> gpu: drm: core: Convert printk(KERN_<LEVEL> to pr_<level> gpu: drm: drivers: Convert printk(KERN_<LEVEL> to pr_<level> drivers/gpu/drm/amd/amdgpu/amdgpu.h | 3 +- drivers/gpu/drm/amd/amdgpu/amdgpu_afmt.c | 4 +-

On Fri, Feb 15, 2019 at 11:08 AM Gustavo A. R. Silva <gustavo at embeddedor.com> wrote: > > In preparation to enabling -Wimplicit-fallthrough, mark switch > cases where we are expecting to fall through. > > Warning level 3 was used: -Wimplicit-fallthrough=3 > > Notice that, in some cases, the code comment is modified > in accordance with what GCC is expecting to find.

I have followed all the examples of installing gca I have been able to find. I have found the main page for installing the program here: http://appdb.winehq.org/objectManager.php?sClass=version&iId=16036 I am running: Ubuntu 9.04 GCA 4.0.371 wine 1.1.28 and the error: modForms:BuildSmartBar: Error 30001: Unable to open the picture file "%1" when gca is loading the current loading

In preparation to enabling -Wimplicit-fallthrough, mark switch cases where we are expecting to fall through. Warning level 3 was used: -Wimplicit-fallthrough=3 Notice that, in some cases, the code comment is modified in accordance with what GCC is expecting to find. This patch is part of the ongoing efforts to enable -Wimplicit-fallthrough. Signed-off-by: Gustavo A. R. Silva <gustavo at

Use a more common logging style. Miscellanea: o Coalesce formats and realign arguments o Neaten a few macros now using pr_<level> Signed-off-by: Joe Perches <joe at perches.com> --- drivers/gpu/drm/amd/amdgpu/amdgpu.h | 3 +- drivers/gpu/drm/amd/amdgpu/amdgpu_afmt.c | 4 +- drivers/gpu/drm/amd/amdgpu/amdgpu_atpx_handler.c | 4 +-

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

A version using regular expressions, regexpr() and substr() functions is attached. Finally everything is packed into splitSeq() function (chunk 14 in the attached file) Seq<- "GCCTCGATAGCTCAGTTGGGAGAGCGTACGACTGAAGATCGTAAGGtCACCAGTTCGATCCTGGTTCGGGGCA" Str<-

On Mon, Feb 27, 2017 at 05:31:04PM -0800, Joe Perches wrote: > Use a more common logging style. > > Miscellanea: > > o Coalesce formats and realign arguments > o Neaten a few macros now using pr_<level> > > Signed-off-by: Joe Perches <joe at perches.com> I know this is pain, but can you pls split this into: - amd/radeon drivers - drm core (anything

I want to use a diallel analysis in R, for some of my own data. I've been through the primary literature and textbooks, and remain stumped as to how to implment this in R. I can illustrate the problem using a published example dataset: [Cockerham and Weir (1977) Quadratic Analyses of Reciprocal Crosses. Biometrics, Vol. 33, No. 1 pp. 187-203] In this study, 8 different individuals were

There are ~4300 uses of pr_warn and ~250 uses of the older pr_warning in the kernel source tree. Make the use of pr_warn consistent across all kernel files. This excludes all files in tools/ as there is a separate define pr_warning for that directory tree and pr_warn is not used in tools/. Done with 'sed s/\bpr_warning\b/pr_warn/' and some emacsing. Miscellanea: o Coalesce formats and

There are ~4300 uses of pr_warn and ~250 uses of the older pr_warning in the kernel source tree. Make the use of pr_warn consistent across all kernel files. This excludes all files in tools/ as there is a separate define pr_warning for that directory tree and pr_warn is not used in tools/. Done with 'sed s/\bpr_warning\b/pr_warn/' and some emacsing. Miscellanea: o Coalesce formats and

There are ~4300 uses of pr_warn and ~250 uses of the older pr_warning in the kernel source tree. Make the use of pr_warn consistent across all kernel files. This excludes all files in tools/ as there is a separate define pr_warning for that directory tree and pr_warn is not used in tools/. Done with 'sed s/\bpr_warning\b/pr_warn/' and some emacsing. Miscellanea: o Coalesce formats and

Joe Perches (2): drm: Use pr_cont where appropriate gpu: drm: Convert printk(KERN_<LEVEL> to pr_<level> drivers/gpu/drm/amd/amdgpu/amdgpu.h | 3 +- drivers/gpu/drm/amd/amdgpu/amdgpu_afmt.c | 4 +- drivers/gpu/drm/amd/amdgpu/amdgpu_atpx_handler.c | 4 +- drivers/gpu/drm/amd/amdgpu/amdgpu_device.c | 4 +-

On Sat, 17 Oct 2020, Joe Perches wrote: > On Sat, 2020-10-17 at 09:09 -0700, trix at redhat.com wrote: > > From: Tom Rix <trix at redhat.com> > > > > This is a upcoming change to clean up a new warning treewide. > > I am wondering if the change could be one mega patch (see below) or > > normal patch per file about 100 patches or somewhere half way by

On Sat, 17 Oct 2020, Joe Perches wrote: > On Sat, 2020-10-17 at 09:09 -0700, trix at redhat.com wrote: > > From: Tom Rix <trix at redhat.com> > > > > This is a upcoming change to clean up a new warning treewide. > > I am wondering if the change could be one mega patch (see below) or > > normal patch per file about 100 patches or somewhere half way by

Thank you sir for your prompt reply. Currently i am stuck at point where I need to call an available Matlab program from an R 2.4.0 interface. How can I do this? I have downloaded the R.matlab file and also the manual in pdf. But still i am not able to get through the problem. I will be grateful to you if you can elaborate me on this. Awaiting your reply, regards, Bhanu Kalyan K

Hello all, For some work I am doing on RNA, I want to use R to do string parsing that (I think) is like a simplistic HTML parsing. For example, let's say we have the following two variables: Seq <- "GCCTCGATAGCTCAGTTGGGAGAGCGTACGACTGAAGATCGTAAGGtCACCAGTTCGATCCTGGTTCGGGGCA" Str <-

Hi all, This series aims to fix almost all remaining fall-through warnings in order to enable -Wimplicit-fallthrough for Clang. In preparation to enable -Wimplicit-fallthrough for Clang, explicitly add multiple break/goto/return/fallthrough statements instead of just letting the code fall through to the next case. Notice that in order to enable -Wimplicit-fallthrough for Clang, this change[1]

Hi all, This series aims to fix almost all remaining fall-through warnings in order to enable -Wimplicit-fallthrough for Clang. In preparation to enable -Wimplicit-fallthrough for Clang, explicitly add multiple break/goto/return/fallthrough statements instead of just letting the code fall through to the next case. Notice that in order to enable -Wimplicit-fallthrough for Clang, this change[1]