similar to: Some questions about NUT driver development

Hello, The UPS I am developing a driver to is able to report several flags for critical hardware conditions, like overheat, overload, inverter failure, output short etc. What should be the correct policy of operation when such a condition occurs? I think that the an UPS in such a condition is not reliable and therefore a system shutdown should be called. However, the developer's manual and

Hi everyone! I need to create a rule that return back the packages sender. For example, if the IP 200.xxx.xxx.xxx tries to connect to my firewall in one specific port, the rules turns back the connection to 200.xxx.xxx.xxx. With this rule the Engineers Department will test some equipments with GSM chips. One point to observe is that we don''t know witch IP will connect to this rules.

I don't remember anything other that what I've written in the bug João has mentioned. Probably something like this patch http://llvm.org/bugs/show_bug.cgi?id=14410#c6 ? 2013/2/20 João Matos <ripzonetriton at gmail.com>: > I think so. There have been other reports lately related to this being > wrong. > > http://llvm.org/bugs/show_bug.cgi?id=14410 > > CC'ing

The patch looks incorrect. The code just needs to handle \1 properly and clang extended to add explicit \1 to the names which does not require mangling. I do not think that moving whole mangling to clang is a good idea, because then everyone who uses LLVM to call WinApi functions will need to mangle by hands. On Wed, Feb 20, 2013 at 11:25 PM, Timur Iskhodzhanov <timurrrr at google.com>

Hi everyone! First of all, sorry about my bad English and the e-mails extension. I need some help to implement a VPN connection using shorewall and openswan as IPSec Tunnel. My network map: CLIENT VPN APPLIANCE --> +++INTERNET+++ --> FIREWALL --> OPENSWAN SERVER (DMZ) I have two VPN connections with two different subnets to the other end. The two of then are correctly established.

Hello Ilia, On 17 February 2017 at 11:14, Ilia Mirkin <imirkin at alum.mit.edu> wrote: > On Fri, Feb 17, 2017 at 10:54 AM, João Paulo Rechi Vita > <jprvita at gmail.com> wrote: >> I'm happy to file >> a bugzilla entry and provide any other needed information or help with >> testing. Are nouveau bugs tracked on bugs.kernel.org or the fdo >> bugzilla?

Anton, what do you think of David's patch with this test case? OK to commit that? On Wed, Feb 20, 2013 at 12:43 PM, Anton Korobeynikov < anton at korobeynikov.info> wrote: > The patch looks incorrect. The code just needs to handle \1 properly > and clang extended to add explicit \1 to the names which does not > require mangling. > > I do not think that moving whole

On Tue, Feb 19, 2013 at 2:13 PM, Duncan Sands <baldrick at free.fr> wrote: >> My question: Is there an easy way of disabling the name-mangling part >> but keep the rest of the CC that I missed? > if you use "\1" + "usual name", it will disable name mangling if you are > lucky. A leading \1 is LLVM's way of saying: leave this name alone! Seems like

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Hi Everyone! I''m having problems to redirect an UDP port to an external server. My firewall have 4 interfaces: NET, LOC (192.168.0.0/24), DMZ(192.168.1.0/24), CMTC(10.0.0.0/24). On CMTC interface I have a direct connection to another network using a VPN link. I need to redirect an UDP port to on server (10.1.0.2) on CMTC zone using my local IP (192.168.0.1) for gateway. I will use

I added a linux server to the Active Directory domain, I realized that the samba-winbind package uses the smb.conf file, but I also need to use the same linux server with shares, if I install the samba package, this package use the smb.conf file. Is there a solution? Then i have problem with 2 services. Example systemctl services: smb.service winbind.service My system is Centos 7. --

When I build LLVM, the message LLVMHello ignored -- Loadable modules not supported on this platform is shown and the LLVM Hello pass doesn't work. I am using Windows. Is this correct? LLVM Hello pass works only on Linux? Thanks. -------------- next part -------------- An HTML attachment was scrubbed... URL:

I think so. There have been other reports lately related to this being wrong. http://llvm.org/bugs/show_bug.cgi?id=14410 CC'ing Timur since he might know more about this. On Wed, Feb 20, 2013 at 5:27 PM, David Nadlinger <code at klickverbot.at>wrote: > On Tue, Feb 19, 2013 at 2:13 PM, Duncan Sands <baldrick at free.fr> wrote: > >> My question: Is there an easy way

+LLVMdev On Aug 4, 2012, at 9:45 AM, João Matos wrote: > Charles Davis did a lot of work on Win64 SEH support in LLVM, check commits r131652-r132880. > > As I haven't tested it yet, what exactly is broken? It's not finished yet. All the stuff for assembly code that uses Win64 EH is done, but not the code-gen-side stuff (cf. Win64Exception class in CodeGen). I was about to

o grupo de RoR é em português? -- You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group. To post to this group, send email to rubyonrails-talk-/JYPxA39Uh5TLH3MbocFF+G/Ez6ZCGd0@public.gmane.org To unsubscribe from this group, send email to rubyonrails-talk+unsubscribe@googlegroups.com. For more options, visit this group at

Hi, for a backup program I have to find all differing files (including metadata) in two snapshots taken from the same subvolume. Having looked at the find-new command I thought about this process: 1. Get the two transids when the two snapshots were created. 2. Query modifications to the original subvolume between the two transids. Is the general process corrent or have I overseen

On Aug 6, 2012, at 1:03 PM, João Matos wrote: > 1. How is clang going to discover the input operands, output operands, > constraints, and clobbered registers? > > The approach you described sounds good to me. Reusing all the work done in the LLVM MC layer seems the right approach. Glad you agree. We really shouldn't be replicating information in the frontend; this very error

For the current project I'm working on (https://github.com/mono/CppSharp) having the flags to change the ABI based on a GCC version would be ideal. If there are no flags, this means we must implement some logic to change the calling conventions of methods manually to how they were pre-4.7. Should not be a lot of work but it'd be best to contain all the C++ ABI details inside Clang itself.

hi all, what is the best way to deal with non-english characters? for example, I have a field withthe value "joão" after saving the value "João". How do I deal with this issue? Thnaks -- Posted via http://www.ruby-forum.com/. --~--~---------~--~----~------------~-------~--~----~ You received this message because you are subscribed to the Google Groups "Ruby on

Hello, I'm working on a Asus X756UQK laptop with nvidia + intel graphics cards. After a suspend-resume cycle, the machine hangs on shutdown, requiring a forced power off. After resuming I sometimes see the following messages on the kernel log: [ 186.117539] nouveau 0000:01:00.0: DRM: evicting buffers... [ 186.118105] nouveau 0000:01:00.0: DRM: waiting for kernel channels to go