similar to: [LLVMdev] InsertElementInst and ExtractElementInst

Hi Gordan, I received my Asus GTX 480 today (bought on ebay). Finally I succeeded in - quadrifying my GTX 480  into a Quadro 6000 ( softmod). - overpassing the 3-4GB of RAM on Windows XP 64 bits (domU) by applying a well known patch for Xen. - playing Crysis 2 and Darksiders II for a few minutes. http://img11.hostingpics.net/pics/953254ScreenshotXenSoftModedQuadro6000.png Using nvlfash I

Hello everybody, What I am trying to do is to create a vector <4 x i32> and save some values to initialize the vector. However, I am using the insertElementInst() and the errors I get are the following; error: within this context Instruction *Insert = new InsertElementInst(instr, emptyVec, index0, "test"); and error: ‘llvm::InsertElementInst::InsertElementInst(llvm::Value*,

Hello, I'm sorry if this seems similar to my last post but I thought it was significantly different to warrent a new thread. Using the dataset below, is there a way to generate a bar/line plot for the TACC/Catch of every lvl of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an example of the bar/line plot for OR1 which was generated when OR1 was the only stock in the

Hi Soham, You're right that in LLVM IR arithmetic (with the current definition of `undef`) is not distributive. You can't replace `A * (B + C)` with `A * B + A * C` in general, since (exactly as you said) for A = `undef`, B = `1`, C = `-1` the former always computes `0` while the latter computes `undef`. This is fundamentally because replacing `A * (B + C)` with `A * B + A * C`

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <-

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow

Estimados Estoy entrenando hacer funciones que respondan a comandos, en esta caso en la salida gráfica se observa que dice : Exposure=var3 y outcome=var 1 quisiéramos que se reflejan los nombres de la base de datos : var1=estado, var2=cake, var3=chocolate Espero haberme explicado adecuadamente Adjunto tabla con datos #################################### #Comando que llama

Hi Everyone, Have created a bar plot of the data below using the following code: barplot(TACC,space=0,names.arg=Year). I now want to add a series of connected points to represent the catch. I tried to do this using line(Catch) or points(Catch), however both of these commands result in each data point being aligned with the right edge of each bar. I need them to be solid points in the centre of

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to

# is there a bug in the calculation of the odds ratio in fisher.test? # Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010 x1 = c(rep(0, 244), rep(1, 209)) x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40)) or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/ (sum(x1==1&x2==0)*sum(x1==0&x2==1)) library(epitools) or2 = oddsratio.wald(x1, x2)$measure[2,1] or3 =

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"),

On 12/9/2016 11:03 AM, Jim Lewis via llvm-dev wrote: > > Thanks, that helps enormously! The issue is that the match is supposed > to support both cascade and tree OR patterns, but there appears to be > a problem with the tree matching. Both test1 and test6 in the ARM > tests exercise the cascade pattern, and I remember now our fix is > confined to the tree case. > > I

Hello, This is the first time i'm trying to plot in R. I want to plot estimates of OR and their confidence limits, like a scatter plot: the vertical axis should be the estimated OR (with upper and lower conf. limits), and the horizontal exis should be fixed values: (1,0.8,0.7,0.6,0.5,0.4) Here is a part of my code: ...ests=matrix(ncol=3,nrow=6)

Hola LLVMers, I'm looking to make use of the vectorization primitives in the Intel chip with the code we generate from LLVM and so I've started experimenting with it. What is the state of the machine code generated for vectors? In my tinkering, I seem to be getting some wonky machine instructions, but I'm most likely just doing something wrong and I'm hoping you can set me in

>> Are you sure there isn't any test coverage? As far as I can tell, the tests from https://reviews.llvm.org/rL133503 are still in the tree. I looked at those, but none of them include the full pattern that decomposes into bswap and rol. I debugged through the X86 bswap.ll test and verified none of those cases make it through MatchBSwapHWord (they get handled in MatchBSwapHWordLow

Hi Carlos, Jakob, The PBQP allocator was designed to support a very wide range of constraints, and can handle something like this easily. Say you have 4 of these orX/irX registers, then for any pair of virtual registers used in such an add instruction you would add the following constraint matrix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0

On 12/02/2011 06:32 PM, Hal Finkel wrote: > On Fri, 2011-12-02 at 17:07 +0100, Tobias Grosser wrote: >> On 11/23/2011 05:52 PM, Hal Finkel wrote: >>> On Mon, 2011-11-21 at 21:22 -0600, Hal Finkel wrote: >>>>> On Mon, 2011-11-21 at 11:55 -0600, Hal Finkel wrote: >>>>>> > Tobias, >>>>>> > >>>>>>

Hola LLVMers, I was curious about the state of stack alignment on x86. I noticed there are a few bugs outstanding on the issue. I recently added some code which had the effect of throwing an extra function parameter on our stack at runtime, a 4 byte pointer. Esp is now not 16-byte aligned, so instructions like unpcklps xmm1, dword ptr [eps] cause grief. My AllocaInstr instructions are

On Fri, 20 Jul 2007, Chuck Rose III wrote: > I'm looking to make use of the vectorization primitives in the Intel > chip with the code we generate from LLVM and so I've started > experimenting with it. What is the state of the machine code generated > for vectors? In my tinkering, I seem to be getting some wonky machine > instructions, but I'm most likely just doing