similar to: [LLVMdev] FYI: ccg

Displaying 20 results from an estimated 6000 matches similar to: "[LLVMdev] FYI: ccg"

2008 Oct 18
1
strange h323 delay issue
Hello, I have a strange h323 issue. After executing command "Dial("SIP/333-0d1dfe00", "H323/361737052390920 at ccg|5|tT")" at Oct 18 22:32:23. Meanwile I have sniffing traffic on port 1720. The call was established just at Oct 18 22:33:03 (New H.323 Connection created.) and also packet sniffer grabs the h323 invites at this time also. So my question is what
2007 Apr 05
0
[LLVMdev] Integrating LLVM in an existing project
Hi Nicolas, On Thu, 2007-04-05 at 14:10 +0200, Nicolas Geoffray wrote: > Hi everyone, > > After some time hacking on llvm, let me introduce myself :) > I'm a PhD student at the French university Pierre et Marie Curie in > Paris. I work on a project > called the "Virtual Virtual Machine" project. You can find some (dated) > information on the > website
2014 Dec 13
0
DCB 4.1 spec update
On Wed, Dec 10, 2014 at 07:46:16AM +1000, Ben Skeggs wrote: > On Wed, Dec 10, 2014 at 7:36 AM, Ben Skeggs <skeggsb at gmail.com> wrote: > > On Wed, Dec 10, 2014 at 4:26 AM, Andy Ritger <aritger at nvidia.com> wrote: > >> Hi, > > Hey Andy, > > > >> > >> The VBIOS on GM20x GPUs uses a slightly updated version of the DCB. > >>
2014 Dec 14
1
DCB 4.1 spec update
On Sat, Dec 13, 2014 at 6:42 PM, Andy Ritger <aritger at nvidia.com> wrote: > On Wed, Dec 10, 2014 at 07:46:16AM +1000, Ben Skeggs wrote: >> On Wed, Dec 10, 2014 at 7:36 AM, Ben Skeggs <skeggsb at gmail.com> wrote: >> > On Wed, Dec 10, 2014 at 4:26 AM, Andy Ritger <aritger at nvidia.com> wrote: >> >> Hi, >> > Hey Andy, >> > >>
2016 Mar 02
0
Debugging second dvi output on quadro fx380 not working
<adding nouveau-devel to the Cc> Hi Ben, On 02-03-16 04:23, Ben Skeggs wrote: > On 03/01/2016 09:37 PM, Hans de Goede wrote: <snip> >> Ok, I've but an mmiotrace of the blob starting with a monitor connected >> to the troubesome connector here: >> >> https://fedorapeople.org/~jwrdegoede/mmiotrace.log.xz >> >> And a demmio-ed version (with
2005 Sep 29
1
lmer random effect model matrix question
I have one fixed effect, sor, with two levels. I have eight lots and three wafers from each lot. I have included the data below. I would like to fit a mixed model that estimates a covariance parameter for wafer, which is nested in lot, and two covariance parameters for lot, one for each level of sor. The following command fits the model that I want, except for it estimates the correlation
2020 Mar 05
0
[PATCH 15/22] drm/tegra: Use simple encoder
The tegra driver uses empty implementations for its encoders. Replace the code with the generic simple encoder. Signed-off-by: Thomas Zimmermann <tzimmermann at suse.de> --- drivers/gpu/drm/tegra/drm.h | 2 -- drivers/gpu/drm/tegra/dsi.c | 10 +++------- drivers/gpu/drm/tegra/hdmi.c | 9 +++------ drivers/gpu/drm/tegra/output.c | 6 +----- drivers/gpu/drm/tegra/rgb.c | 8
2004 Mar 17
2
Installing Samba
Hi I am trying to install Samba on a QNX 4.24 system. When we run the make file we get an error : compiling server.c make:cc:command not found make: *** [server.o] error 127 Can you help with this! Lucille Shears Systems Analyst CCG/DFO shearsl@dfo-mpo.gc.ca (709) 772-3131 cell (685-1512)
2008 Nov 12
1
Two problems with Samba in AD realm
Hello list. I recently moved to an AD environment. I'm still keeping a samba servers to make my cups-managed printers available to windows users, rather than duplicating configuration with a Windows print service. But I'm facing two problems, probably due to the way we manage AD. First, all my host belong to a Unix-managed DNS domain (msr-inria.inria.fr), not to the windows-managed
2018 Feb 05
0
[PATCH 2/3] drm/nouveau/disp: quirk for SOR crossbar routing
With DCB 4.1 implemented by VBIOS since GM20x GPUs, SOR crossbar routing should be possible, such that any SOR sublink can drive any macro link. Unfortunately, there's at least one card where some SOR sublinks being connected to a particular macro link are causing failures. To work around this issue, supply a quirk for such cards which prevents a dynamic mapping of SOR sublink and macro link
2018 Feb 05
0
[PATCH v2 2/3] drm/nouveau/disp: quirk for SOR crossbar routing
With DCB 4.1 implemented by VBIOS since GM20x GPUs, SOR crossbar routing should be possible, such that any SOR sublink can drive any macro link. Unfortunately, there's at least one card where some SOR sublinks being connected to a particular macro link are causing failures. To work around this issue, supply a quirk for such cards which prevents a dynamic mapping of SOR sublink and macro link
2013 Jul 30
0
[PATCH] drm/nv50-/disp: use the number of dac, sor, pior rather than hardcoded values
The values are already stored on chipset specific basis in the ctor. Make the most of them and simplify the code further by using a temporary variable to avoid code duplication. Signed-off-by: Emil Velikov <emil.l.velikov at gmail.com> --- Found this patch laying around in a local branch. While the it does not reduce the number of lines, I believe that it makes the code is alot more
2017 Jan 17
0
[PATCH 1/6] drm/nouveau: Extend NVKM HDMI power control method to set InfoFrames
The nouveau driver, in the Linux 3.7 days, used to try and set the AVI InfoFrame based on the selected display mode. These days, it uses a fixed set of InfoFrames. Start to correct that, by providing a mechanism whereby InfoFrame data may be passed to the NVKM functions that do the actual configuration. At this point, only establish the new parameters and their parsing, don't actually use
2018 Feb 05
2
[PATCH 0/1] drm/nouveau/disp: prefer identity-mapped route of SOR <-> macro link
Hi Ben, still _assuming_ it's an issue of the card I thought about why it works with the NVIDIA binary driver. And I can image they're just trying to do an identity-mapping first and if that doesn't work (e.g. the particular SOR is already in use by another macro link) they just pick the next suitable one. So the case would be that the NVIDIA binary driver always assignes the only
2009 Jan 27
0
samba, ADS and privileges management
Hello list. I once had a samba server acting as a PDC, a mapping between my NT 'Domain admins' and Unix 'admins' groups, and everything worked perfectly. Now I got a new shiny samba server acting as a print server only, member of an AD domain, and I can't have the members of 'Domain admins' group manage printing drivers on the server, whereas the Administrator
2018 Feb 05
0
[PATCH 3/3] drm/nouveau/pci: SOR crossbar quirk for 10b0:1b81
On Mon, Feb 5, 2018 at 12:19 PM, Danilo Krummrich <danilokrummrich at dk-develop.de> wrote: > On 2018-02-05 02:39, Ben Skeggs wrote: >> >> On 5 February 2018 at 11:37, Ben Skeggs <skeggsb at gmail.com> wrote: >>> >>> On 5 February 2018 at 11:22, Danilo Krummrich >>> <danilokrummrich at dk-develop.de> wrote: >>>>
2007 Apr 05
1
[LLVMdev] Integrating LLVM in an existing project
Hi Reid Reid Spencer wrote: > > Interesting project. I wish you could talk about it at the Developer's > Meeting (http://llvm.org/DevMtgMay2007.html :) > > I wish I could! Unfortunately there is very little chance I get the fundings to go to the US in May. > > I have signed up to implemented this (PR1269) just as Chris' note > states. HLVM needs it for much
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2017 Dec 20
0
[bug report] null ptr deref in nouveau_platform_probe (tegra186-p2771-0000)
On Thu, Dec 14, 2017 at 04:09:14PM -0500, Anthony Eden wrote: > With linux-next-2017-12-14, I get a crash when nouveau is loaded by > systemd-udevd. > > [ 12.050625] Unable to handle kernel NULL pointer dereference at virtual > address 00000058 > [ 12.050627] Mem abort info: > [ 12.050628] ESR = 0x96000004 > [ 12.050630] Exception class = DABT (current EL), IL
2013 Feb 28
0
[LLVMdev] [vmkit] Errors compiling vmkt
Hi Minas, Basically, you should not have any difference between the two projects :) (it's not really the case, but we are working on this problem). To explain (sorry for my long email!), I work for a french research institution (Inria) and, as we have an Inria research project around VMKit, I had to create a repository inside my institution (a researcher has always to make his institution