similar to: pregunta

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <-

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

# is there a bug in the calculation of the odds ratio in fisher.test? # Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010 x1 = c(rep(0, 244), rep(1, 209)) x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40)) or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/ (sum(x1==1&x2==0)*sum(x1==0&x2==1)) library(epitools) or2 = oddsratio.wald(x1, x2)$measure[2,1] or3 =

Hi Gordan, I received my Asus GTX 480 today (bought on ebay). Finally I succeeded in - quadrifying my GTX 480  into a Quadro 6000 ( softmod). - overpassing the 3-4GB of RAM on Windows XP 64 bits (domU) by applying a well known patch for Xen. - playing Crysis 2 and Darksiders II for a few minutes. http://img11.hostingpics.net/pics/953254ScreenshotXenSoftModedQuadro6000.png Using nvlfash I

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"),

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to

Hi Carlos, Jakob, The PBQP allocator was designed to support a very wide range of constraints, and can handle something like this easily. Say you have 4 of these orX/irX registers, then for any pair of virtual registers used in such an add instruction you would add the following constraint matrix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0

Hi all, Does anyone know if an R function for the Mantel-Haenszel chi-square for a 2x2 table exists? I’ve also seen it called the randomization Q statistic. Note that I’m not looking for the Cochran-Mantel-Haenszel…I did see that out there as cmh.test. Thanks in advance, Jeff Internal Virus Database is out-of-date. Checked by AVG Free Edition. 11:27 AM [[alternative HTML version

Hello, I'm sorry if this seems similar to my last post but I thought it was significantly different to warrent a new thread. Using the dataset below, is there a way to generate a bar/line plot for the TACC/Catch of every lvl of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an example of the bar/line plot for OR1 which was generated when OR1 was the only stock in the

Hi Everyone, Have created a bar plot of the data below using the following code: barplot(TACC,space=0,names.arg=Year). I now want to add a series of connected points to represent the catch. I tried to do this using line(Catch) or points(Catch), however both of these commands result in each data point being aligned with the right edge of each bar. I need them to be solid points in the centre of

Hi, I use the epicalc package which provides the function aggregate.numeric. Unfortunately aggregate.numeric produces warnings when aggregate is used by functions not under my control on a numeric value. If I don't load epicalc, aggregate.default is used instead by these functions and does not produce any warning. However I need epicalc. So to get around this, what I would do is firstly

Hello, I am create a <3 x i32> vector in LLVM IR. Then I insert 3 instructions and later on I try to load one instruction from the vector. The insertion seems to work, however, when I try to load a specific instruction from a vector I seems that it does not work. This is the part of my IR: %"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0 %"ins and2"

Dear R Users; I am an R user who has recently bought a new laptop;Toshiba Satellite U405 running on both Windows Vista and Ubuntu. I have problems on the wondows vista when installing packages. The argument 'lib' is missing. How do i solve this problem? Illustration: > install.packages("epicalc") Warning in install.packages("epicalc") : argument 'lib'

Dear all, I installed my R-2.9.2 on my ubuntu version 9.04 successfully using the command sudo apt-get install r-base-dev The problem is that I cannot install any package. See my details below: > install.packages("epicalc") Warning in install.packages("epicalc") : argument 'lib' is missing: using '/home/lmramba/R/i486-pc-linux-gnu-library/2.9'

Anyone out there have a functional DUNDi configuration using SIP for the inter-Asterisk transport? I've gotten it to work with IAX2, but if I change it to SIP it does not pass the call over even though it knows where to send it. Thanks. The contents of this email message and any attachments are confidential and are intended solely for addressee. The information may also be legally

Dear All, I installed R 2.7.0 and tried to call a dataset i had ealier own called on R2.6.2 but i keep on getting an error: use("maltreat.dta") Error in fromchar(x) : character string is not in a standard unambiguous format Tried doing the same with R2.7.1 but i get the same error. However if i call the same on R 2.6.2, there is no error: use("maltreat.dta") > des()

Dear R-friends, ? I am using the epicalc package and the manual by V. Chongsuvivatwong "Analysis of epidemiological data using R and Epicalc" to get the hang of some basic epidemiological analyses.??? ? After running all the analyses of chapter 7, one is supposed to wrap it up by saving the data writing: ? ? > save(.data, file = "Chapter7.Rdata") ? ...?after writing the

Hi, I have been able to generate association rules for Market Basket Analysis using the following codes: **************************************************************************** ******************************************* library("arules") rules <- read.csv("write1.csv",na.strings=c(".", "NA", "", "?"),header=TRUE)

On 12/9/2016 11:03 AM, Jim Lewis via llvm-dev wrote: > > Thanks, that helps enormously! The issue is that the match is supposed > to support both cascade and tree OR patterns, but there appears to be > a problem with the tree matching. Both test1 and test6 in the ARM > tests exercise the cascade pattern, and I remember now our fix is > confined to the tree case. > > I