similar to: questions on subscores.

I have no idea, but Google pointed me to this https://cran.r-project.org/web/packages/subscore/index.html Hth Ulrik "Hyunju Kim" <asdfg4882 at yonsei.ac.kr> schrieb am Di., 15. Mai 2018, 07:21: > > > > Hello, > > > > I want to compute Wainer et al's augmented subscore(2001) using IRT but I > can't find any packages or relevant code. > >

Hi All, I'm generating 10 different data sets with 1 and 0 in a matrix form and writing the output in separate files. Now I need to stack all these data sets in one vector and I know that stack only operates on list or data frame however I got these data sets by converting list to a matrix so can't go backwards now. Is there a way i can still use Stack? Please see the program:

Dear all, I'm struggling to find the best (set of?) function(s) to do repeated measures logistic regression on some data from a psychology experiment. An artificial version of the data I've got is as follows. Firstly, each participant filled in a questionnaire, the result of which is a score. > questionnaire ID Score 1 1 6 2 2 5 3 3 6 4 4 2 ...

I am trying to simulate a dataset using Parallel Latent CTT model and this is what i have done so far: (START) #Importing psych library for all the simulation related functions library(psych) # Settting the working directory path to C:/NCME path="C:/NCME" setwd(path) #Using the function to generate the data GenData <- congeneric.sim(N=500, loads =

Dear Renato, Thank you for the prompt reply. But could you please remove ``Yonsei'' after my name (Yousun Ko), and capitalize the paper title as below? LaminarIR: Compile-Time Queues for Structured Streams Thank you very much in advance. Best regards, Yousun Ko 2016-10-20 21:56 GMT+01:00 Renato Golin <renato.golin at linaro.org>: > Added in r284775. > >

On Jan 10, 2014, at 4:46 PM, Ariel Wainer wrote: > On 10/01/14 01:53, Charles Lepple wrote: >> I am curious about why the Interrupt Out packet is sent by the Windows software if it isn't to turn off the UPS. Is it possible to do some more testing with shorter timeouts so that the battery doesn't get depleted? You would need to record the exact time when it shuts down, I think.

On 20/12/13 21:22, Charles Lepple wrote: > > Maybe Dan, the maintainer of the nutdrv_qx driver, has better insight on this, but my uneducated guess is that I don't think it is Megatec/Qx. The logs don't show any commands going down to the UPS, just Interrupt Read requests to EP1IN. > > It definitely won't be covered by stock usbhid-ups either, although it does implement the

On 21/12/13 21:31, Ariel Wainer wrote: > > Ok, I did this, here is how it went (approximately): > t=0 power on the UPS, with some load. > t=2 min unplug the UPS from mains, alarm goes off. > t=33 min low battery alarm goes off. > t=35 min ups powers down. > Ok, trying to make sense of the capture (again: it's all guessing, I have no experience with usb protocol): Up

On Jan 17, 2014, at 6:31 PM, Ariel Wainer wrote: > On 17/01/14 01:13, Charles Lepple wrote: >> >> Good point. I forgot that the permissions errors would happen after the numeric device IDs were matched. >> >> I just pushed 3c13603. Tested by telling the driver to match a random USB device instead of 0001:0000, and sure enough, when the driver didn't have write

On 11/01/14 15:27, Charles Lepple wrote: > On Jan 10, 2014, at 4:46 PM, Ariel Wainer wrote: > >> On 10/01/14 01:53, Charles Lepple wrote: >>> I am curious about why the Interrupt Out packet is sent by the Windows software if it isn't to turn off the UPS. Is it possible to do some more testing with shorter timeouts so that the battery doesn't get depleted? You would

On Jan 1, 2014, at 1:52 PM, Ariel Wainer wrote: > Very strange! It seems like the completly powered down and OK status > yeild the same reading. The reading didn't change after plugging back in > the AC. Well, as strange as that is, I don't think it would be a common case. Ordinarily, the load would be the computer monitoring the UPS, and if the load is off... We can certainly

http://web.nvd.nist.gov/view/vuln/detail?vulnId=CVE-2014-1692 The NIST advisory says that all versions of OpenSSH potentially contain the flaw. ?But is that really true? ?For example, I looked at the 3.8.1p1 distribution and didn't find any reference to JPAKE at all. Thanks.

Hi Folks, Please, when I ask the option reg.line at the scatterplot in package car, the OLS models includes a constant? If not how can I do it sing the following code: scatterplot(lfirms ~ lscale, data=dataset, reg.line=lm, smooth=FALSE, labels=FALSE, span=0.5, xlab="Relative Plant Fixed Cost", ylab="Relative Number of Firms", pch=c(18),

Dear R Users, There is no R keyboard control in my R terminal. Specifically, I can not use the up and down arrows, use autocomplete, or ?backspace? to delete. I am using R 3.3.3 on Linux <snip> 2.6.18-164.el5 #1 SMP Thu Sep 3 03:28:30 EDT 2009 x86_64 x86_64 x86_64 GNU/Linux Is this an R bug? Best, -R

Dear all, I am trying to optimize a logistic function using optim, inside the following functions: #Estimating a and b from thetas and outcomes by ML IRT.estimate.abFromThetaX <- function(t, X, inits, lw=c(-Inf,-Inf), up=rep(Inf,2)){ optRes <- optim(inits, method="L-BFGS-B", fn=IRT.llZetaLambdaCorrNan, gr=IRT.gradZL, lower=lw, upper=up, t=t, X=X)

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

To whom it may concern, Hi, this is Yousun Ko at the Computer Lab., University of Cambridge. I would like to propose a paper of mine which has been published at PLDI'15 to be listed in the ``LLVM Related Publications.'' The paper presents a new intermediate representation, LaminarIR, to enhance SSA form promotions in structured stream programs. The LLVM compiler infrastructure is used

On Dec 21, 2013, at 11:36 PM, Ariel Wainer wrote: > On 21/12/13 21:31, Ariel Wainer wrote: >> >> Ok, I did this, here is how it went (approximately): >> t=0 power on the UPS, with some load. >> t=2 min unplug the UPS from mains, alarm goes off. >> t=33 min low battery alarm goes off. >> t=35 min ups powers down. >> > > Ok, trying to make

On 17/01/14 23:47, Charles Lepple wrote: > On Jan 17, 2014, at 6:31 PM, Ariel Wainer wrote: > >> On 17/01/14 01:13, Charles Lepple wrote: >>> >>> The rule in my config was: >>> >>> ATTR{idVendor}=="0001", ATTR{idProduct}=="0000", MODE="664", GROUP="nobody" >>> >>> I have to add OWNER=nobody or

On Dec 26, 2013, at 9:40 PM, Ariel Wainer wrote: >> It might be possible to tell usbhid-ups to match on the 0xFFA0 usage page, and ignore all of the other HID PDC definitions. I'll poke around the code. > > Ok, let me know if you need anything else. I tryed the instructions at > http://www.networkupstools.org/docs/developer-guide.chunked/ar01s04.html > , but it didn't