similar to: Winbind backend = ldap pull uid-number and gid-number ldap values ?

Displaying 20 results from an estimated 2000 matches similar to: "Winbind backend = ldap pull uid-number and gid-number ldap values ?"

2011 Oct 28
2
NT4 SP3 PDC with MS Exchange 5.5 to Samba 3.x ldapbacked PDC and MS Exchange 5.5 still
Looking to make some changes to an old but working LAN, that has about 10 samba servers serving printers and network shares and a NT 4 PDC server with Exchange 5.5 on it. The samba servers are members of the nt4 domain, XP systems are members of the nt 4 domain also. Samba servers are ldapbacked. We use the ldap component directly to login to the Linux servers. I'd like to be able to
2011 Oct 28
3
NT4 SP3 PDC with MS Exchange 5.5 to Samba 3.x ldapbac ked PDC and MS Exchange 5.5 still
>>I have a client in a similar situation. NT4 PDC w/Exchange 5.5 and Samba member servers. Main problem is that >>they're running an old custom Outlook/Exchange workflow app which locks them in until it can be replaced. Similar situation - though we've been able to replicate it fairly easily in google apps. >>As you're aware newer then XP cannot join an NT4 domain
2019 Apr 09
1
Problems getting POSIX ACL working on upgraded samba file server Ubuntu 16.04 LTS to 18.04 LTS
Running a Samba 4 AD DC on Ubuntu 18.04, and fileservers on 18.04. Our access control needs are rather simple and worked well under the samba 3 series with LDAP users and groups so we plan to keep using the POSIX ACL (regular filesystem access controls) On a fresh install file server(18.04) samba 4 with POSIX ACLs work with no issue, but I can't get the permissions to work properly on the
2009 Mar 24
2
gidNumber's and ldap backed samba PDC
In the planning process for migrating from NT4 PDC, and external ldap directory to samba 3.2.8 PDC. The external existing openldap directory is used currently to support the local uid mapping for the Linux logins and samba file servers that are members of the current NT4 PDC. While looking at the existing openldap UIDs and GIDs in use and what the samba PDC wants to use I see some uid/gid
2018 Jun 07
2
Windows 10 clients slow remapping drives and somewhat inconsistent in reconnecting to the saved map drives
Hello, I'm a long term samba user through many different flavors from FreeBSD to Linux. My latest is using Ubuntu 16.04 with its older version of the 4.2 series of samba as an AD DC and separate 4.2 series file server. In my small test environment the Samba 4.2 AD DC and the Samba 4.2 file server are different LXC containers on the same host. I've worked through many of the
2014 Jan 08
1
Samba4 AD DC Domain name question
I've been working on setting up the Sernet 4.1x series samba builds for Centos 6. Provisioned via sudo /usr/bin/samba-tool domain provision --use-rfc2307 -interactive With the goal of providing authentication, user and group management with file and print services to Widows 7/8 clients, & authentication user and group management for Linux system users. The question is around my confusion
2005 Jul 28
1
using pam_winbind to authenticate against AD/krb
hey all, after following the directions in the "FreeBSD Active Directory Domain Member Mini-HOWTO" http://web.irtnog.org/howtos/freebsd/winbind i am able to get my machine to the point where i can query users with 'wbinfo': $ wbinfo -u|grep galbrecht galbrecht i am unable, however, to login to my machine using any service, telnet for example: $ telnet -K localhost
2012 Jun 25
2
setdiff datframes
hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all
2003 Sep 16
2
can predict ignore rows with insufficient info
I need predict to ignore rows that contain levels not in the model. Consider a data frame, "const", that has columns for the number of days required to construct a site and the city and state the site was constructed in. g<-lm(days~city,data=const) Some of the sites in const have not yet been completed, and therefore they have days==NA. I want to predict how many days these sites
2013 Apr 26
2
Can a column of a list be called?
Hello Everyone, I would like to know if I can call one of the columns of a list, to use it as a variable in a function. Thanks in advance for any advice! Jana -- Jana Makedonska, B.Sc. Biology, Universite Paul Sabatier Toulouse III M.Sc. Paleontology, Paleobiology and Phylogeny, Universite de Montpellier II Ph.D. candidate in Physical Anthropology and Part-time lecturer Department of
2013 Apr 08
3
extensions.conf / test DID
I am trying to make sure my DID and SIP account details are working properly and engaging the extensions.conf and dial plan. I have a successful SIP session registered: Connected to Asterisk 11.3.0 currently running on Asterisk (pid = 922) Asterisk*CLI> sip show registry Host dnsmgr Username Refresh State Reg.Time sip3.voipvoip.com:5060
2011 Dec 15
1
Inquiry about matrix pooling
Dear R-users, I am a relatively new R user and I have a simple question. Is there a command attached to a R function, which performs matrix pooling? Thanks in advance, Jana -- -- "The world is full of mysteries. Life is one. The curious limitations of finite minds are another."(J.B.S. Haldane, The Causes of Evolution) Jana Makedonska, M.Sc. Ph.D. candidate/ Part-time lecturer
2013 Apr 26
2
Help with dataEllipse function
Hi Everyone, I am working with the R function "dataEllipse". I plot the 95% confidence ellipses for several different samples in the same plot and I color-code the ellipse of each sample, but I do not know how to specify a different line pattern for each ellipse. I can only modify the pattern for all ellipses with the "lty" argument. Any help will be highly appreciated.
2014 Jun 29
2
Winbind does not read uidNumber
Well, seems like I hit every mudhole that could be on the way ... root at samba4:/# getent passwd | grep mgr mgr:*:10000:10000:Lars LH. Hanke:/home/AD/mgr:/bin/bash root at samba4:/# ldapsearch -LLL -D "CN=Administrator,CN=Users,DC=ad,DC=microsult,DC=de" -x -W '(uid=mgr)' uid uidNumber gidNumber sAMAccountName name gecos Enter LDAP Password: dn: CN=Lars LH.
2008 Sep 26
1
howto convert matrix of numeric values to Date class?
Hi: I have a matrix, named "mat," of numeric values that are in days since Jan 1, 1960. I want to convert them Date class values so that I can do things like seq( value , len=10, by="1 week") where "value" is any of the matrix elements. How do I do this? Please reply to: philipsmith at alumni.albany.edu Thanks! Phil Smith Duluth, GA
2008 Jul 23
3
how can I write code to detect whether the machine is Windows or Linux?
Hi R-People: I use 2 machines: a machine with a Windows XP operating system, and another with a Linux Ubuntu OS. I transport my code between these 2 machines. However, pathnames to data files always need to be "adjusted" to account for the OS that I'm working on. Here is my question: How do I write code to detect whether I'm using the XP or the Linux machine? If I knew
2015 Jun 22
2
OT: default password for HP printer
On 06/22/2015 03:57 PM, Tim wrote: > The manual doesn't say anything about a user or password. > http://h10032.www1.hp.com/ctg/Manual/c03026243.pdf > > Search for EWS. I don't know this model but it can't be that hard. Yeah, as said in my original post, I have googled for the answer... and extensively... three different search strings. And I've read posts up to five
2005 Oct 20
1
Windows 2000 crash while using rbind (PR#8225)
Windows 2000 reports that "Rgui.exe has generated errors and will be = closed by Windows. You will need to restart the program." when using = rbind.=20 df1 <- data.frame(cbind(x=3D1, y=3D1:1000), fac=3Dsample(LETTERS[1:3], = 1000, repl=3DTRUE)) df2 <- data.frame(cbind(x=3D1, y=3D1:10), fac=3Dsample(LETTERS[4:6], = 10, repl=3DTRUE)) df3 <- data.frame(cbind(x=3D1,
2002 Nov 05
1
getent not working / winbindd issues
I first start smbd -D and nmbd -D Then I start winbindd Then I join the domain (smbpasswd -j DOMAIN -r DOMAINCONTROLLER -U Administrator) It works Then I check my Secret (wbinfo -t) and it's good Then I list users and groups (wbinfo -u and wbinfo -g) and it works fine However I still cannot get "getent passwd" and "getent group" working, it just lists the local users
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >