Displaying 20 results from an estimated 1100 matches similar to: "Dynamically printing a page"
2006 Mar 09
13
[prototype] how i send Dynamic form field values??
I want to know how can i send the values of form fields build dynamic
with prototype.
i have the form as follow:
<form id="id" method="post" action="url">
<div id="dynamicFields"></div>
</form>
with prototype i fill the dynamicFields DIV with <input> and <select>
tags, but when i submit the form the values of
2006 Apr 27
5
proposing $E & $T
Hey all,
I''ve had these functions for some time now, and would like to offer them
as two new dollar-sign functions - elements to be extended by Prototype
geniuses. :-)
makeText(string) as $T() - return text node element
Does just what it says... I''m sure someone could extend it nicely when
via Prototype.
(example) var x = $T(''hello world'');
2006 Mar 09
5
Comet support?
Just out of curiosity, is there a plan to support Comet (name coined by the
dojo guys) w/ prototype? Comet represents persisting an http connection for
low latency data operations. It also represents a nice alternative to
polling.
Jim
_______________________________________________
Rails-spinoffs mailing list
Rails-spinoffs-1W37MKcQCpIf0INCOvqR/iCwEArCW2h5@public.gmane.org
2006 Mar 31
9
File upload progress bar
I''ve seen a few demos online, for php, but I''m looking for a file upload
progress bar implementation with Prototype. Can anyone point me in a good
direction for one?
I''m not using Rails, so I can''t use the upload_progress addon,
unfortunately.
Thanks for any info
Jim
_______________________________________________
Rails-spinoffs mailing list
2009 Jul 15
3
Axes origins and labeling
I have re-labeled tick marks on the x axis. The problem is that by using
axes=FALSE, the axes disappears and when they are called back using
axis(side=1)..etc. the axis on sides 1 and 2 do not meet at the bottom left
corner of the graph. I would also like to have the 3rd and 4th axes in
there as well, all meeting in their respective corners.
par(mfrow=c(1,2))
gut<-c("Full",
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
--
View this message in context:
2005 Mar 08
4
Non-linear minimization
hello, I have got some trouble with R functions nlm(),
nls() or optim() : I would like to fit 3 parameters
which must stay in a precise interval. For exemple
with nlm() :
fn<-function(p) sum((dN-estdata(p[1],p[2],p[3]))^2)
out<-nlm(fn, p=c(4, 17, 5),
hessian=TRUE,print.level=2)
with estdata() a function which returns value to fit
with dN (observed data vactor)
My problem is that only
2006 Jun 27
14
iframe ... does it have an innerHTML ?
If I dynamically create a hidden iframe, how could I add a document in a
string to that element?
e.g.,
var sDocument = ''<html><head></head><body>Hello world.</body></html>'';
I''ve tried several variations of appendChild, innerHTML, document.innerHTML,
createTextNode.
Argh!
_______________________________________________
2007 Jul 24
4
How to pull the title and url from an iframe?
I have an iframe in which the user can browse. When they hit the ''add
this page'' button i need to retrieve the url and the title of the page
currently shown in the iframe.
Does anyone know how to do this? Do i need to assign a variable name to
my iframe? (currently it just sits in my template as a bit of html)
--
Posted via http://www.ruby-forum.com/.
2008 May 15
3
Facebooker support for iframe apps
Hi facebooker-ers,
It looks to me like facebooker does not currently support iframe
facebook apps - or am I missing something?
My first problem as I understand it is as follows - When you are
logged into facebook, and access a facebook application,
facebook tacks on a whole lot of extra fb_sig parameters to the
request (including fb_sig_user) that the application can then
validate to
2006 Apr 10
4
Element.getDimensions() support for IE?
Hey all,
I''m not sure if IE can support this, but I''m trying to get the dimensions of
an element that has percentages for height/width. In the example code
below, I''m trying to get the dimensions for the ''MyCell'' element. Firefox
supports Element.getDimensions(''MyCell''), but IE returns 0 for the height &
width returned by that
2006 Apr 18
4
Security considerations with displaying uploaded HTML
I have an application where I am allowing users to upload (or refer the
app. to) arbritrary HTML that I am (currently) displaying in an IFRAME
on a page. The users will be authenticated so it''s not open to the
entire universe.
I was always uneasy with this, but after reading the security chapter of
AWDWR, I am even more concerned.
What kinds of applications do people have out there
2006 May 29
3
IFRAME based RJS - responds_to_parent
** File uploads with AJAX mojo **
Respond with RJS to your parent window with a form action targeted to
a hidden IFRAME. Handles all the painful situations like scoping
your JavaScript to your parent window generating the script block for
execution and clearing the IFRAME after execution so the back button
doesn''t re-execute the action.
`plugin install
2009 May 07
5
Controller redirect_to to leave iframe
Inside an iframe, I want the controller to redirect_to to the parent
(i.e. target =''_parent'').
Any ideas?
(Everything I''ve tried- via redirect_to - just keeps it inside the
iframe)
2008 Jun 03
7
Iframe shenanigans
Here''s my problem. Unfortunately I have the need to load up fully
qualified html documents
into my page. (think tens of thousands of mini sites). I also have the
need to be as handicap accessible as possible. (So ajax is essentially
out, screen readers aren''t up to snuff yet). Thus I''m using an iframe.
The unfortunate part
is that I have navigation menus that appear over
2005 Oct 21
3
Windows interacting with SAMBA share
Hi,
My company has a Samba [3.0] share on a Debian Linux 3.0 [Kernel 2.6]
machine and we are trying to copy a large file [>2GB] from a Windows
machine to the Samba share. When we try to do this, it only copies 2GB
of the information. We were previously having a similar issue when
transfering a large file [>2GB] from Linux to a Windows share [mounted
as smbfs], but fixed that with the
2005 Sep 15
2
IE iframe bug with Autocompleter over HTTPS
I ran across an issues using the Autocompleter over HTTPS in IE (6.0
in WinXP Pro SP2).
I plan to submit a bug report to the Ruby on Rails trac, but first I''d
like "to discuss this on th[is] Mailing List beforehand, maybe it''s
already known and in the works, or it isn''t a bug" (per
http://wiki.script.aculo.us/scriptaculous/show/BugReports)
The autocomplete
2006 Jul 20
7
Can this be done?
What I want: I get a normal http request containing a URL from a remote
server.
Instead of redirecting to that URL, I want to load it into an iframe on
an existing page.
I''ve tried a number of approaches with no success.
Can anybody suggest a good way to do this? Alternatively, if you can say
"this is bloody impossible, because....", that would be helpful, too.
--Al Evans
2007 Mar 13
2
mime types
I''m trying to use the ajax.Updater function to send a message to the
server and display an error message. Ok so far. However if the server
detects no error with the data sent I want to open a PDF file in a new
window. When I try to do this (using fpdf) the returned PDF is opened
as text in the error div.
Can anyone point me in the right direction.
rgds
gmcb
2006 Jun 26
2
Drag''n''drop DOM elements between (I)FRAMEs
I am quite disappointed in the drag ''n'' drop support in Mozilla Firefox.
What am trying to achieve is dragging an element from one IFRAME/FRAME into
another IFRAME/FRAME. But upon dropping the element, I do not want the
target IFRAME/FRAME to open/load it. I want it simply to handle the event,
such as parsing the element/data dropped. Such uses as dropping an element
into a