similar to: How to select the scale parameter for Gabor transform (Rwave)?

Displaying 20 results from an estimated 100 matches similar to: "How to select the scale parameter for Gabor transform (Rwave)?"

2003 Aug 05
1
Rwave cgt plot time axis problem
Dear helpers, When I use the function cgt of library Rwave, the time axis of the plot is always on the [0,1] scale regardless of the original time. This happedn when I tried to reproduce some pictures of "Practical Time-Frequency Analysis", e.g. Figure 3.5 and 3.6 using the codes provided in the book. But the figures of the book display the real sampling time using the same codes.
2010 Mar 25
4
3 levelplots and 1 colorbar
I want to create a simple plot containing three levelplots with one colorbar. I used the "Three levelplots" code below, but the third levelplot is drawn smaller than the first two. However, if I try the "Two levelplots" code below it works well. Can anybody tell me how could I draw three levelplots (of the same size) with one colorbar. Thanks in advance, Joaquin ### Three
2006 Feb 21
1
wireframe, axis label-axis separation, xlab rotation
Greetings, A couple of questions: 1. I am using wireframe. It prints 3d plots nicely on screen, but when I use a postscript device the z-axis label merges with the z-axis. Is there any option to control their separation? 2. Again, using wireframe, I rotate the whole plot using the screen parameter. However, the x- and y-axis labels (xlab and ylab) remain horizontal. How could I rotate them?
2008 Dec 02
1
help with package Rwave
I am looking for some explanations about the usage of the poorely documented R paclkage Rwave. Has anyone ever tried out its functions for Wavelet Analysis ? Thank you so much. Maura Alice Messenger ;-) chatti anche con gli amici di Windows Live Messenger e tutti i telefonini TIM! Vai su http://maileservizi.alice.it/alice_messenger/index.html?pmk=footer [[alternative HTML version deleted]]
2001 Jul 26
0
data for Rwave package
Hi, I just installed the new Rwave package. On the Win2000 platform it will not find its data files (it does fine under Linux). Here is what I do: (1) library(Rwave) (2) data() - this correctly reports all the data sets available (3) data(HOWAREYOU) - this fails on Win2000 machine with the following message Error in file(file, "r") : cannot open file
2004 Sep 15
0
RWAVE axis notation
I am using Rwave wavelets and I need better axis notation. Does anyone have code similar to matlab's centfreq or scale2frq functions that turn a scale for a wavelet transform into a good looking scale to plot on my wavelet transfoms? I am using the rwave package to investigate seismic signals from an exploding volcano. Jonathan Lees -- ==========================================
2014 Oct 18
3
[LLVMdev] Performance regression on ARM
Hi Chandler, That's embarrassing how weird this part of clang is. I have a provisional patch which fixes the problem but underlines clang's problems. I will submit it tonight for comments. суббота, 18 октября 2014 г. пользователь Chandler Carruth написал: > > On Fri, Oct 17, 2014 at 7:51 AM, Anton Korobeynikov < > anton at korobeynikov.info >
2007 Jan 28
2
reposTools
Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am
2007 Jun 26
1
ts() defunct in R 2.5.0?
Hi! I have written an R-package (http://tocsy.agnld.uni-potsdam.de/wavelets/index.html) in R 2.4.1 that requires the ts() function. Users using R 2.5.0 now have a problem installing this package. I checked the package using R 2.5.0: _______________________________________________________ * Installing *source* package 'sowas' ... ** libs gcc -std=gnu99
2012 Apr 26
6
print table on plot
Hello, I would like to be able to plot an array on a plot, something like: |arg1 | arg2 | arg3 val1| 0.9 | 1.1 | 2.4 val2| 0.33 | 0.23 | -1.4 val3| hello| stop | test I know Rwave is good to report but don't want to use it. ? Is there a package that allow quick and dirty plot of dataframes like this ? Thanks a lot -- View this message in context:
2005 Dec 02
1
Tidal Time Series Analysis in R
I am looking at using R to analyze time series data containing a tidal component. I need to remove the tidal signal to extract the time series of the phenomena I seek to study. A browse of R-project search engines has not been too fruitful? I've found 'hoa' and 'Rwave', but need further help getting started. THANKS. -wa
2012 Oct 08
1
[LLVMdev] Fwd: Multiply i8 operands promotes to i32
Hello Pedro, As others have said we're assuming that you're using Clang as the frontend, the MSP430TargetInfo class inside lib/Basic/Targets.cpp (clang codebase) set ints to be 16 bits wide, so you should get 16bit mults straight away without promotion. But anyways for 8bit multiplicantions you can do the following to bypass argument promotion: 1) go to the lib/CodeGen/TargetInfo.cpp
2009 Jun 04
1
Morlet wavelet analysis
Dear, I am using "cwt "function from Rwave package to perform Morlet wavelet analysis. d1<-c(1.31673209591515, -0.171333455797346, -1.67618546079420, -0.931604651010362, -0.954614183224057, -1.19821794547758, 0.516096363353144, -0.0432811977638559, 0.737764943619919, 0.438046629673177, -0.208607167908743, -0.3091308821262, -1.42473112931594, 0.234125312118165, -0.307047554490597,
2006 Apr 13
1
Guidance on step() with large dataset (750K) solicited...
Hi. Background - I am working with a dataset involving around 750K observations, where many of the variables (8/11) are unordered factors. The typical model used to model this relationship in the literature has been a simple linear additive model, but this is rejected out of hand by the data. I was asked to model this via kernel methods, but first wanted to play with the parametric
2001 Oct 11
2
Where's MVA?
Hi All: Package TSERIES is stated to depend on MVA. However, there is no MVA package to be found under the list of package sources. Best wishes, ANDREW tseries: Package for time series analysis Package for time series analysis with emphasis on non-linear and non-stationary modelling Version: 0.7-6 Depends: ts, mva, quadprog Date: 2001-08-27 Author: Compiled by Adrian
2010 Jul 19
1
Hurst Exponent Estimation
Dear All, I am a novice when it comes to time-series analysis and at the moment I am actually interested in calculating the Hurst exponent of a time series. This question has already been asked quite some time ago http://bit.ly/98dZsi and I trust some progress has been made ever since. I was able to find some functions in the packages http://cran.r-project.org/web/packages/Rwave/index.html
2009 Mar 22
1
using wavelet transform to calculate mean frequency of a signal
Dear list, in short: I would like to calculate the mean frequency of a signal (e.g. time series) using the wavelet transform. with details: I did not find a R function to calculate a mean frequency using one of the cran packages. My searches using R Site Search returned: **(1)waveclock {waveclock} R Documentation Reconstruction of the modal frequencies in a time series using continuous
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2004 Aug 30
3
Generalized Singular Value Decomposition (GSVD)
Dear R-users, I couldn't find a function or some help in R-project web about the Generalized Singular Value Decomposition. In MatLab there is a simple function for this algebric issue (gsvd). Is there anything like that in R? And, if not, could you help me to apply this method in R? Thanks in advance, Giancarlo +++++ This mail has been sent through the MPI for Demographic Rese...{{dropped}}
2008 Jun 11
0
[LLVMdev] some warning from VS2005 (requested by gabor)
Hi, Some random sample of VS warning: Lot of 64 bits conversions: AsmPrinter.cpp ..\..\lib\CodeGen\AsmPrinter.cpp(277) : warning C4244: 'initializing' : conversion from 'uint64_t' to 'unsigned int', possible loss of data ..\..\lib\CodeGen\AsmPrinter.cpp(614) : warning C4244: 'argument' : conversion from 'uint64_t' to 'int', possible loss of data