similar to: Sequence analysis

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

I am trying to count the number of times that the characters in a string change For example- new=c(AAAABBBBBABBBABB) I want to find the number of times that B changes to A and the number of times that A changes to B. I tried the grep command but I only figured out the positions of when B changes to A when I only need the number of times it occurs. -- View this message in context:

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

On 03/02/2015 02:38 AM, Oliver Welter wrote: > Guys, dovecot is open source - if you desire a feature that the upstream > programmer did not include, pay him a bounty to do so or send him a > patch to be included. Period. We can discuss and mightbe somebody will > fork if he is not willing to accept such a solutuion for any political > reason. > > I am really tired of reading

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Steffen Kaiser wrote: > passdb { driver = ipdeny args = <host>/matchpattern/action .... > *** } > With next passdb{} as 1st in chain: passdb { driver = checkpassword args = "/tmp/chktst ip=%r service=%s" result_success = continue result_failure = return-fail } and this script BEGIN /tmp/chktst #!/bin/bash echo

Hi, I was wondering I'm going about this in the correct way. I need to test if there are coding sequences or exons in hg19 which match a string of 100bp "D" i.e. [A,G or T]. However I'm getting a strange result. I get a hit on chr7, using the 100bp search however when I search with 60bp sequence of "D" I don't get any hits. library("BSgenome")

Is there a function to efficiently search for a subsequence within a vector? For example, with x <- 1:100 I'd like to search for the sequence c(49,50,51), and be told that it occurs exactly once, starting at location 49. (The items in the vectors might be numeric or character, and there might be repetitions within the search pattern or within the vector I'm searching.) Duncan

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

Good day, The location of indels can be retrieved from a PairwiseAlignmentsSingleSubject object by using indel. Determining any difference between the two sequences, including substitutions, is not quick nor easy. I suppose that summary displays details of the mismatches, but the variable is of class PairwiseAlignmentsSingleSubjectSummary which has no documented accessors. So, the code to access

Hi there, I am looking for R-packages that can help me visualize properties on nucleotide sequences. I want to display sequences in the 1-100K base range as lines and plot features above and below those lines. Any ideas would be welcome. Thanks, Bernd [[alternative HTML version deleted]]

I need to increment cells of a matrix (collusionM). The indexes to increment are in an index (matchIndex). This is some of the code for (j in 1:(rows-1)) matchIndex[[j]] <- which(mx[j]==mx) for (j in 1:(rows-1)) collisionM[j,matchIndex[[j]]] <- collisionM[j,matchIndex[[j]]] + 1 I could put them in the same loop but this is slower. The first for statement is fine. It finds the matches

-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 On Mon, 2 Mar 2015, Dave McGuire wrote: > On 03/02/2015 02:38 AM, Oliver Welter wrote: >> Guys, dovecot is open source - if you desire a feature that the upstream >> programmer did not include, pay him a bounty to do so or send him a >> patch to be included. Period. We can discuss and mightbe somebody will >> fork if he is

Hello , I am not sure what the best solution is, but, in my hands using Org-mode version 8.3.2-elpa org-20150929 the reg-expt used to "cleanup extra prompts left in output" is over-aggressive and will trim session :output at lines consisting exclusively of blanks and periods such as produced when printing a BioConductor 'Views' object which wants to appear as #+RESULTS:

Dear R-helpers: thank your for your attention. i am a newer to R and i am doing some protein category classification based on the amino acid sequence.while i have some questions urgently. 1. any packages for analysis amino acid sequence 2. given two sequences "AAA" and "BBB",how can i combine them into "AAABBB" 3. based on "AAABBB",how can i get some

Hello, I have a big number lets say of around hundred digits. I want to subset that big number into consecutive number of 5 digits and find the product of those 5 digits. For example my first 5 digit number would be 73167. I need to check the product of the individual numbers in 73167 and so on. The sample number is as follows: