similar to: Ask for help: find corresponding elements between matrix

Hello, I've got a data frame with a mix of numeric, integer and factor columns. I'd like to pull out (or just operate only on) the numeric/integer columns. Every thing I've found in searches is about how to subset by rows, or how to operate assuming you have the column names.  I'd like to pull by type. Thanks! Barry [[alternative HTML version deleted]]

Hi everyone, I have a data frame Gene with SNPs eg. P1 P2 P3 CG CG GG -- -- AC -- AC CC AC -- AC I tried to replace all the GG with a value 3. Gene[Gene=="GG"]<-3 It always give me: Warning in `[<-.factor`(`*tmp*`, thisvar, value = 3) : invalid factor level, NAs generated Does any know if there is anything wrong with my code? Thanks, Zhengyu

Hi, I want to make a plot similar to sm1 (attached). The code I tried is: dcols <- densCols(x,y) smoothScatter(x,y, col = dcols, pch=20,xlab="A",ylab="B") abline(h=0, col="red") But it turned out to be s1 (attached) with big dots. I was wondering if anything wrong with my code. Thanks,Zhengyu -------------- next part -------------- A non-text

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Dear all, I am stuck on the following problem with integrate(). I have been out of luck using RSiteSearch().. My function is g2<-function(b,theta,xi,yi,sigma2){ xi<-cbind(1,xi) eta<-drop(xi%*%theta) num<-exp((eta + rep(b,length(eta)))*yi) den<- 1 + exp(eta + rep(b,length(eta))) result=(num/den)*exp((-b^2)/sigma2)/sqrt(2*pi*sigma2)

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

I've tried without success to calculate interaction and main effects contrasts using R. I've found the functions C(), contrasts(), se.contrasts() and fit.contrasts() in package gmodels. Given the url for a small dataset and the two-way anova model below, I'd like to reproduce the results from appended SAS code. Thanks. --Dale. ## the dataset (from Montgomery) twoway <-

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

Dear R helpers, I am working with R 2.4.1 GUI 1.18 (4038) for MacOSX. I have a matrix of 10 000 genes and try to run the following commands: > model.mix<-makeModel (data=data, formula=~Dye+Array+Sample+Time, random=~Array+Sample) > anova.mix<-fitmaanova (data, model.mix) > test.mix<-matest (data, model=model.mix, term="Time", n.perm=100, test.method=c(1,0,1,1))

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

!urgent! Hi all. I am facing a problem plotting a indicatormatrix to visualize the pattern. Matrix consist from 1's and 0's. for example x <- matrix(c(0,0,1,0, 1,1,1,1, 0,0,0,1, 1,0,1,1), nrow = 4, ncol=4) an i want to have a plot like | . | . . . . | . | . . . |_______> I thinking of somethink like a for loop, which creates a data point whenever

Hi, today I have built dovecot from cvs sources, and upgraded server from beta-7 to this newer version. Then i got problems with opening INBOX using thunderbird 1.5.0.2. The client says "Opening folder...", then, after about half a minute, blinking "connecting to the server" and returning to "Opening folder..." /var/log/maillog gets the messages: --- Jun 22

Two simple build fixes for libldm. Well, the first isn't a build fix as such, but a code improvement. Rich.