similar to: subtotals based on price bands?

Hi! I have large matrices, one column per variable and I have a vector of factors / grouping symbols. Then I am computing subtotals for the groups but it takes pretty long and thus I wanted to ask if there is a better way to do it or if this is already the best way: subTotals <- function(x, groupvec) do.call("rbind",lapply(split(x,groupvec),colSums,na.rm=T)) Thanks reading my

Hi, To pretty print aggregates by various dimensions I needed to add a empty row in output of aggregate. For example. d<-(aggregate(data[,cbind("x")], by=list(data$group1,data$group2), sum)) Group.1 Group.2 x 1 A N 3 2 A Y 2 3 B N 420164905 Is there a way to add an empty

Hello, list,   I've been struggling with this task for a while looking for an efficient way to solve it: There are two variables 'price' and 'mentioned'. I want to 'enlarge' data so that missing price points within the price range are added to variable price. Also variable 'mentioned' is to receive values 0 in these cases. Note: Price points in original data can

Dear all R users : I am a IT student with few statistical background and new R user for only have two month exprience. I have a data named medcost, import by read.table() as follow for example (real dataset has 500 cases), the heander id means case id, member means members in a family and cost is the family pay for medical cost every 6 months. id member cost 1 4

I have a dataset in which I have identified a three-way interaction. Factor A has 3 levels, factor B has 4 levels, and factor C has 3 levels. I would like to produce the following: 1) A manova in which I can test the effect of factor C for each combination of factor A * factor B. I know how to do this using a series of "do" commands, but I wonder whether there is a more

Dear R-users, I have a dataset as like below, and I want to subtotal the values of rice,wheat and maize by year for each fid. fid      year     rice     wheat      maize ------------------------------------------------ 1        1995      5        NA           NA 1        1995      NA        3           NA 1        1995      NA       NA           2 1        1996      4        NA           NA 1  

Hi; I've been playing around with various report writers on the cdr_mysql table and I'm getting rather irritated. I started a thread a couple weeks ago on "Billing Fun" and got a lot of good responses on how to get an up-to-date copy of the NDA/NXX database, which I managed to retrieve and bring into MySQL in a script from the various pieces of code people posted... very nice.

Hi, I have two products which are substitudes. I try to fix a system as below to mydata. Demand1 = A1 -B1*Price1 + C1*Price2 Demand2 = A2 +B2*Price1 - C2*Price2 I would expect C1 & B2 to be symmetric, If they are truly substitude. How can I enforce this symmetry when creating a system of equations via SystemFit ? -- View this message in context:

Dear All, I would like to make partial sums (or means or any other function) of the values in intervals along a sequence (spatial transect) where groups are defined. For instance: habitats<-rep(c("meadow","forest","meadow","pasture"),c(10,5,12,6)) observations<-rpois(length(habitats),2)

Hi, I have a simple swift code from which I generate IR code with ‘swiftc test.swift -emit-ir -o test.ll' When I try to run the .ll file or apply optimization with opt, I get errors like this one: lli: test.ll:548:110: error: expected instruction opcode %9 = cmpxchg i64* bitcast (%swift.type*** @field_type_vector_TipCalculator to i64*), i64 0, i64 %8 seq_cst seq_cst

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

I have two files with dates and prices in each. The number of rows in each of them will differ. How do I create a new file which contains data from both these files? Cbind and merge are not helpful. For cbind because the rows are not the same replication occurs. Also if I have similar data how do I write a vlookup kind of function? I am giving an example below: Say Price1 file contains the

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Hi, I am trying to run many different regressions using a FOR Loop. The input data that is read into R has the following variables · Volume · Price1 · Price2 · Price3 · Price4 · Price5 · Trend · Seasonality I want to run 5 regressions, with the Volume as an dependent variable and Price, Trend & Seasonality as

Hi, 2015-10-05 11:49 GMT+02:00 Rinaldini Julien via llvm-dev <llvm-dev at lists.llvm.org>: > Sorry, the error is (the previous one was from Apple’s lli): > > Documents/strong.codes/code/build/obfuscator-llvm/bin/opt: test.ll:57:203: error: expected comma after getelementptr's type > @_METACLASS_DATA__TtC4test13TipCalculator = private constant { i32, i32, i32, i32, i8*, i8*,

I know this is for CentOS stuff, but I'm at a loss on how to build a script that does what I need it to do.? It's probably really logically simple, I'm just not seeing it.? Hopefully someone will take pity on me and at least give me a big hint. I have a file with two columns 'email' and 'total' like this: me at example.com 20 me at example.com 40 you at domain.com

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of