similar to: referencing headers to extract components of a data frame

It is very wierd... Can some of you confirm the following behavior ? It is a new bug (feature ?) which was not yet in 0.49 ... noquote <- function(obj) { ## constructor for a useful "minor" class if(!inherits(obj,"noquote")) class(obj) <- c(class(obj),"noquote") obj } "[.noquote" <- function (x, subs) structure(unclass(x)[subs], class =

The source to the noquote() function looks like this: noquote <- function(obj, right = FALSE) { ## constructor for a useful "minor" class if(!inherits(obj,"noquote")) class(obj) <- c(attr(obj, "class"), if(right) c(right = "noquote") else "noquote") obj } Notice what happens with right =

In S, NULL and list() are not the same. In R they are (I think). --------------------------------------------------- At least, is.list(NULL) #-> 'F' in S; 'TRUE' in R Yes: I had an instance where this broke correct S code: match(c("xlab","ylab"), names(list(...))) when '...' is empty, gives an error in R, but gives c(NA,NA) in S.

I currently have a program that automates 2-way ANOVA on a series of endpoints, but before the ANOVA is carried out I want the code to test the assumptions of normality and equal variance and report along with each anova result in the output file.  How can I do this? I have pasted below the code that I currently use.   library(car) numFiles = x #

Hello, I'm having difficulty passing an object name to a lapply function. Can somebody tell me the trick to make this work? #Works T13702 <- TRACKDATA[["13702.xls"]][["data"]] min(unlist(lapply(list(T13702), function(x) mdy.date(x[1, 2], x[1, 1], x[1, 3])))) 16553 #Works d<-2 assign(paste("T",substr(names(TRACKDATA)[d],1,(nchar(names(TRACKDATA)[d]

I haven't been able to get anywhere tracking this down. It seems that c.noquote() does something strange with its third (and subsequent) parameters: R-2.7.0 under NetBSD, R-2.6.0 under Solaris, and R-2.8.0 (unstable) (2008-06-10 r45893) under WinXP, I get: > c(noquote('z'), 'y', 'x', '*') [1] z y x * x * > or: > c(noquote('z'),

G'day all, I am trying to use a string as an argument in a selection but things are not working as I expect, seems the selection is not seeing the expanded string and I do not know how to make it. Perhaps the noquote class value that is returned is the problem. Here is an example. > selection #this is my string [1] "attackprogress$Se=='Toona ciliata [19825: JMM35]'"

Hi, I apologize if the solution is right in front of me, but I can't find anything on how to convert a class of 'noquote' to 'matrix'. I've tried as.matrix and I've tried coercing it by 'class(x)<-matrix', but of course that didn't work. I've been using the function 'symnum' which returns an object of class 'noquote'. Here is an

Dear mailing list members, My question is maybe very basic, but I could not find the solution. I would like to do the following things 1) colnames(V1)[2] <- par$V2[1] colnames(V2)[2] <- par$V2[2] colnames(V3)[2] <- par$V2[3] ... colnames(V37)[2] <- par$V2[37] 2) V1 <- V1[,-1] V2 <- V2[,-1] V3 <- V3[,-1] ... V37 <- V37[,-1] 3) ms <- merge(V1,V2) ms <- merge(ms,V3)

Hi R, When I use the below to write the text file try=data.frame(rep("a",5), rep("b",5)) write.table(try,"z:\\try.txt",row.names=F,col.names=F,sep="\t") the output contains two columns with quotes! Is there a way to write without quotes? I tried try[,1]=noquote(try[,1]) try[,2]=noquote(try[,2]) Thank you, Regards, Ravi Shankar

Dear all, I have the following data frame: > dat V1 V2 V3 V4 V5 V6 V7 V8 V9 1 1 AAAACACCCACCCCCCCCCCCCCCCCCCCCCCCC 9.0 18 12.00 18.0 15.0 12.0 6.0 2 1 ACGATACGGCGACCACCGAGATCTACACTCTTCC 18.0 8 12.00 18.0 15.0 12.0 18.0 3 1 ACTACTGCTCCCCCCCCACTCCCCCCCCCCCCCC 15.0 8 12.00 12.0 18.0 12.0 12.0 4 1 ACTTATACGGCGACCACCGAGATCTACACTCTTT 15.0

Dear XpeRts, I prepared a no qoute Character string by the following command s<-noquote(paste (b1, collapse=",")) where, b1 is the vector of 24 intergers. > dput(b1) c(1L, 2L, 6L, 7L, 12L, 16L, 17L, 20L, 21L, 23L, 25L, 34L, 46L, 48L, 58L, 64L, 65L, 68L, 82L, 97L, 98L, 101L, 113L, 115L) > dput(s)

Dear list, I'm using the brew package to generate a report containing various plots. I wrote a function that creates a plot in png and pdf formats, and outputs a suitable text string to insert the file in the final document using the asciidoc syntax, <% tmp <- 1 makePlot = function(p, name=paste("tmp",tmp,sep=""), width=300) {

Dear all, I am trying to read in and assign data from 50 tables in an automated fashion. I have the following code, which I created with the help of textbooks and the internet, but it only seems to read in the final data file over and over again. For example, when I type:> table_1951 I get the same values in the table as when I type> table_2000 despite the values in the source tables

Hello, I define a dataframe named "Price" first and there are other dataframes as well. Then I built an array named "code" containing all the dataframe name. So If I call code[1], it is "Price". Basicly, I would like to call the datafram with reference to the array"code".e,g, If I want to call dataframe "Prices", I use sth containing code[1]. It

Dear R Users, I am attempting to write a new netCDF file (using the ncdf) package, using 120 grids I've created and which are held in R's memory. I am reaching the point where I try to put the data into the newly created file, but receive the following error: > put.var.ncdf(evap_file, evap_dims, unlist(noquote(file_list))) Error in put.var.ncdf(evap_file, evap_dims,

Hi, if i just want a vector filled with names which has length(index) > 0. For example if nombreC <- c("Juan", "Carlos", "Ana", "Mar?a") nombreL <- c("Juan Campo", "Carlos Gallardo", "Ana Iglesias", "Mar?a Bacaldi", "Juan Grondona", "Dario Grandineti", "Jaime Acosta",

Bug fix: A bug introduced in version 1.6 failed to "initialize" some old-style (aka "S3") classes, producing possible warning messages if those classes were used in the signature of a method in the methods package. The real bug, though, was that old-style inheritance could not be included, until the setOldClass function was provided. Initializing the methods package now

Works fine for me. What do you object to in the following? Calling the above df "d", > dm <- as.matrix(d) > dm Sub_Pathways BMI_beta SAT_beta VAT_beta 1 "Alanine_and_Aspartate" " 0.23820" "-0.02409" " 0.94180" 2 "Alanine_and_Aspartate" "-0.31300" "-1.97510" "-2.22040" 3

Hello all, I've run into what I bet is a silly problem; however, I've been trying to get around it now for a couple weeks and every time I think I have the answer it still doesn't work. So I apologize in advance if this is painfully obvious, but I've run out of ideas and would really appreciate any input. My situation is this, I'm importing a number of tab