similar to: Appending the Column names

Displaying 20 results from an estimated 10000 matches similar to: "Appending the Column names"

2012 Jul 26
5
Getting warning message
Hi Friends, I have a data frame X, and I want to add ?%? & ?$? in row 4 and 5 respectively. when I?m trying using below logic, I?m getting warning message. Can anyone help me out on this. X: Summary G Y R T Accts 582 644 0 1226 AcctCov 230 165 0 395 Cov% 40 26 0 32 UnCov% 60 74 0 68 EqVol11$MM8.5 10.6 0 19.1 Using this logic:
2012 Aug 01
3
Can any one help me on this Issue
Hi Friends, I'm new to R ,I have a data frame Z16 which is genarated from another data frame, and I want to add ?%? & ?$? in row 4 and 5 respectively. when I?m trying using below logic, I?m getting warning message. I'm using R 2.14.2 Version Can anyone help me out on this. Note: Initially i used tranfrom function to do some calculations,where ever it should give zero,its
2012 Jul 24
2
Create a Pivot
Hi Friends, i'm new to R....I have data frame having columns X Y Z....I want to do pivot on this data frame....can any one help me on this... Thanks, Namit -- View this message in context: http://r.789695.n4.nabble.com/Create-a-Pivot-tp4637629.html Sent from the R help mailing list archive at Nabble.com.
2012 Jul 25
3
creating Pivot
Hi Friends, I'm new to R.I have a data frame : xxx having columns color name values R XXX 10 G YYY 4 Y ZZZ 5 G XXX 2
2008 Aug 31
4
give all combinations
Hello,   is there a simple way to give all combinations for a given vector:   v<-c("a","b","c")   combination(v,v) becomes "aa","ab","ac","bb","bc","cc'   combination(v,v,v) becomes "aaa","aab","aac","abb",......     [[alternative HTML version deleted]]
2006 Feb 09
6
gcc4 compiler warnings
Hi all! The following files emits warnings when compiled with gcc 4.0: al175.c bcmxcp_ser.c belkinunv.c cyberpower.c everups.c powercom.c solis.c All warnings seem to be of this variety: everups.c:38: warning: pointer targets in passing argument 2 of 'ser_get_char' differ in signedness I suggest that those who fiddles with those drivers fixes the warnings and verifies that it works
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2006 Jun 26
9
table name
hello freinds... I m very new to ruby on rails and i m facing a problem... whenever i add Scaffold table and try running in that broser it shos error that the particular tbale doesnot exist.... also it changes the name of the table , for eg.table names Recipe gets changed to Recipes and in order to get ountput i need to change the name of the table TO Recipies........is there any reason to
2018 Feb 27
2
Parallel assignments and goto
Interestingly, the <<- operator is also a lot faster than using a namespace explicitly, and only slightly slower than using <- with local variables, see below. But, surely, both must at some point insert values in a given environment ? either the local one, for <-, or an enclosing one, for <<- ? so I guess I am asking if there is a more low-level assignment operation I can get my
2018 Feb 26
0
Parallel assignments and goto
Following up on this attempt of implementing the tail-recursion optimisation ? now that I?ve finally had the chance to look at it again ? I find that non-local return implemented with callCC doesn?t actually incur much overhead once I do it more sensibly. I haven?t found a good way to handle parallel assignments that isn?t vastly slower than simply introducing extra variables, so I am going with
2018 Feb 27
0
Parallel assignments and goto
No clue, but see ?assign perhaps if you have not done so already. -- Bert Bert Gunter "The trouble with having an open mind is that people keep coming along and sticking things into it." -- Opus (aka Berkeley Breathed in his "Bloom County" comic strip ) On Tue, Feb 27, 2018 at 6:51 AM, Thomas Mailund <thomas.mailund at gmail.com> wrote: > Interestingly, the
2014 Apr 08
2
host command output showing wrong domain (Samba4)
Hi I never seen this before, and dont understand where too look for Please share some light on this. the host output is adding a extra domain. example bellow, its showing right IPs followed by NXDOMAIN !!! [root at 171-SYSLOG ~]# host 171-dc-a.xxxx.acc 171-dc-a.test.acc has address 10.254.228.226 171-dc-a.test.acc has address 10.254.225.45 Host 171-dc-a.test.acc not found: 3(NXDOMAIN) Host
2008 Jan 17
2
[LLVMdev] specifying accumulator based load/stores
I have load / store instructions that require accumulator. So a store looks like.. mov 3, acc st acc, addr I have specified "acc" as a separate register class containing only one register which is the "acc". The instr patterns are then splitted into: set imm:$src, ACCClass:$dst (generating the "mov" above) set ACCClass:$src, mem:$dst (generating the
2018 Feb 11
4
Parallel assignments and goto
Hi guys, I am working on some code for automatically translating recursive functions into looping functions to implemented tail-recursion optimisations. See https://github.com/mailund/tailr As a toy-example, consider the factorial function factorial <- function(n, acc = 1) { if (n <= 1) acc else factorial(n - 1, acc * n) } I can automatically translate this into the loop-version
2018 Feb 11
0
Parallel assignments and goto
> On Feb 11, 2018, at 7:48 AM, Thomas Mailund <thomas.mailund at gmail.com> wrote: > > Hi guys, > > I am working on some code for automatically translating recursive functions into looping functions to implemented tail-recursion optimisations. See https://github.com/mailund/tailr > > As a toy-example, consider the factorial function > > factorial <-
2008 Jan 17
0
[LLVMdev] specifying accumulator based load/stores
On Jan 17, 2008, at 4:12 AM, Sanjiv Gupta wrote: > I have load / store instructions that require accumulator. > So a store looks like.. > > mov 3, acc > st acc, addr > > I have specified "acc" as a separate register class containing only > one register which is the "acc". > The instr patterns are then splitted into: > > set imm:$src,
2007 Apr 25
2
assigning two conditions to grep()
Hi, i have a problem in assigning 2 conditions to grep() , my data look like this: DA 24 N7 Rad= 3.4 20 Sac= 0.93 Acc= 4.76 DA 24 N7 Rad= 3.4 14 Sac= 0.65 Acc= 3.33 DA 24 N7 Rad= 3.4 3 Sac= 0.14 Acc= 0.71 DA 24 N7 Rad= 3.4 11 Sac= 0.51 Acc= 2.62 DG 23 N7 Rad= 3.4 8 Sac= 0.37 Acc= 1.91 DG 23 N7 Rad= 3.4 5 Sac= 0.23 Acc= 1.19 DG 23 N7 Rad= 3.4 0 Sac= 0.00 Acc= 0.00 DG 23 N7 Rad= 3.4 3 Sac=
2007 Oct 31
1
Simple Umacs example help..
Hello all... I am just starting to teach myself Bayesian methods, and am interested in learning how to use UMacs. I've read the documentation, but the single example is a bit over my head at the level I am at right now. I was wondering if anyone has any simple examples they'd like to share. I've successfully done a couple of simple gibbs examples, but have had a hard time
2009 May 15
3
Using sample to create Training and Test sets
Forgive the newbie question, I want to select random rows from my data.frame to create a test set (which I can do) but then I want to create a training set using whats left over. Example code: acc <- read.table("accOUT.txt", header=T, sep = ",", row.names=1) #select 400 random rows in data training <- acc[sample(1:nrow(acc), 400, replace=TRUE),] #try to get whats left
2009 Mar 27
1
ROCR package finding maximum accuracy and optimal cutoff point
If we use the ROCR package to find the accuracy of a classifier pred <- prediction(svm.pred, testset[,2]) perf.acc <- performance(pred,"acc") Do we?find the maximum accuracy?as follows?(is there a simplier way?): > max(perf.acc at x.values[[1]]) Then to find the cutoff point that maximizes the accuracy?do we do the following?(is there a simpler way): > cutoff.list <-