similar to: Possible bug in fisher.test() (PR#14196)

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

Hello, I'm sorry if this seems similar to my last post but I thought it was significantly different to warrent a new thread. Using the dataset below, is there a way to generate a bar/line plot for the TACC/Catch of every lvl of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an example of the bar/line plot for OR1 which was generated when OR1 was the only stock in the

Hi Carlos, Jakob, The PBQP allocator was designed to support a very wide range of constraints, and can handle something like this easily. Say you have 4 of these orX/irX registers, then for any pair of virtual registers used in such an add instruction you would add the following constraint matrix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0

Without trying to understand your code in detail let me just assume you are trying to create a matrix, ret, whose i,j-th entry is some function, f, of row i of X and row j of X. In that case this should do it: apply(X,1,function(x)apply(X,1,function(y)f(x,y))) Date: Wed, 30 Jun 2004 15:28:47 -0300 (ART) From: <daniel at sintesys.com.ar> To: <r-help at stat.math.ethz.ch>

here appears to be a bug in the foreign library. The following code used to work, but now generates an error when 'package="SAS"' is specified: ds <- read.csv("http://www.math.smith.edu/sasr/datasets/help.csv") # running foreign package version 0.8-30 library(foreign) # this works fine write.foreign(ds, "foo", "bar", package="Stata") #

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <-

Estimados Estoy entrenando hacer funciones que respondan a comandos, en esta caso en la salida gráfica se observa que dice : Exposure=var3 y outcome=var 1 quisiéramos que se reflejan los nombres de la base de datos : var1=estado, var2=cake, var3=chocolate Espero haberme explicado adecuadamente Adjunto tabla con datos #################################### #Comando que llama

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"),

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow

Hi Gordan, I received my Asus GTX 480 today (bought on ebay). Finally I succeeded in - quadrifying my GTX 480  into a Quadro 6000 ( softmod). - overpassing the 3-4GB of RAM on Windows XP 64 bits (domU) by applying a well known patch for Xen. - playing Crysis 2 and Darksiders II for a few minutes. http://img11.hostingpics.net/pics/953254ScreenshotXenSoftModedQuadro6000.png Using nvlfash I

Hi! Its not an R specific question but had no idea where to ask elsewhere. Does anyone know the orginal reference to the CAMBERA DISTANCE? Eryk. Ps.: I knew that its an out of topic question (sorry). Can anyone reccomend a mailing list where such questions are in topic?

Is there an R package available that would facilitate doing a power/sample size analysis for linear mixed effects models? I have seen the Java applets made available by Russell Length which would seem to be able to handle most any lme, but there is little documentation and it's not clear how the models need to be formulated. Rick B.

How can I compute a power analysis on a multi-factor within-subjects design?

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible Url : https://stat.ethz.ch/pipermail/r-help/attachments/20070404/0f61f54a/attachment.pl

Commit-ID: 1e6e96615227de6ca88d096fb0ebe45bf25981c2 Gitweb: http://git.kernel.org/?p=libs/klibc/klibc.git;a=commit;h=1e6e96615227de6ca88d096fb0ebe45bf25981c2 Author: Ben Hutchings <ben at decadent.org.uk> AuthorDate: Fri, 18 Jan 2019 00:33:51 +0000 Committer: Ben Hutchings <ben at decadent.org.uk> CommitDate: Fri, 18 Jan 2019 03:10:14 +0000 [klibc] arch: Remove m32r port

The parts of klibc specific to the m32r architecture. Signed-off-by: H. Peter Anvin <hpa at zytor.com> --- commit 7ba219f9bcddda38ddc9010b54fd10431292f744 tree 1cf287dfd321d6b980789f49bb0750e8a4217c22 parent 951dc85bd690c6cc5a971815665da947160cbe51 author H. Peter Anvin <hpa at zytor.com> Sun, 25 Jun 2006 16:58:27 -0700 committer H. Peter Anvin <hpa at zytor.com> Sun, 25 Jun

Hi Everyone, Have created a bar plot of the data below using the following code: barplot(TACC,space=0,names.arg=Year). I now want to add a series of connected points to represent the catch. I tried to do this using line(Catch) or points(Catch), however both of these commands result in each data point being aligned with the right edge of each bar. I need them to be solid points in the centre of

Hi, I know LLVM provides thread-level automatic parallel support using OpenMP (see  http://blog.llvm.org/2015/05/openmp-support_22.html), but it is not clear for me which of the following is correct? 1. Clang inserts in the source code OpenMP compiler directives, so, it auto-parallelizes the serial source code provided as input or2. Clang can compile manually written parallel source code that uses

Hello, I am create a <3 x i32> vector in LLVM IR. Then I insert 3 instructions and later on I try to load one instruction from the vector. The insertion seems to work, however, when I try to load a specific instruction from a vector I seems that it does not work. This is the part of my IR: %"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0 %"ins and2"