similar to: install.packages and dependency version checking

This is about the new note Depends: includes the non-default packages: ‘BiocGenerics’ ‘Biobase’ ‘lattice’ ‘reshape’ ‘GenomicRanges’ ‘Biostrings’ ‘bumphunter’ Adding so many packages to the search path is excessive and importing selectively is preferable. Let us say my package A either uses a class B (by producing an object that has B embedded as a slot) from another package or provides a

I recently updated R 2.10.1 Patched (2010-02-20 r51163) This morning I reinstalled biomaRt using biocLite. Now I can no more connect to biomaRt and even the following instruction is hanging for a while until the same error message pops up. > listMarts() Error in value[[3L]](cond) : Request to BioMart web service failed. Verify if you are still connected to the internet. Alternatively the

Hello, Suppose in the following code, PROTECT(sr = R_tryEval( .... )) sr is a RAWSXP vector. I wish to return another RAWSXP starting at position 13 onwards (base=0). I could create another RAWSXP of the correct length and then memcpy the required bytes and length to this new one. However is there a more efficient method? Regards Saptarshi Guha

Hi, I am trying to install Bioconductor onto R version 2.7.0 for Windows. I installed R, then followed the instructions on http://www.bioconductor.org/download, which state that you should type the following: source("http://bioconductor.org/biocLite.R") biocLite() When I do that, I get the following error: Running biocinstall version 2.2.9 with R version 2.7.0 Your version of R

Need way to resize an existing graphics window. This should be applicable across platforms (as part of a package). Context: function1() draws main plot (I'm using grid), function2() adds smaller plot above main plot, but this one can sometimes overflow the original graphics window area. Thanks, Sigal

Neither biocLite nor the GUI menus can install packages on my system. Here is relevant output: > version _ platform i386-pc-mingw32 arch i386 os mingw32 system i386, mingw32 status major 2 minor 11.1 year 2010 month 05 day 31 svn rev 52157 language R version.string R version 2.11.1 (2010-05-31) > source("http://bioconductor.org/biocLite.R") BioC_mirror =

Hi I'm missing something here but I cannot figure out what. What I can see is that the same code works when I load it via source(...) yet fails when I execute it after loading the package I have built (which includes the code. Below is a transcript of my R session. First I load the code from a file, using source(). Then I execute it fine. Then I remove the function object, I load the

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

Hi, when running the following on a fresh R, library("IRanges") annotation showMethods("annotation") Biobase:::annotation showMethods("annotation") I get (see the "^^^^^" marked output at the bottom): > library("IRanges") Carico il pacchetto richiesto: 'IRanges' The following object(s) are masked from package:base :

I have a confusing error from R CMD check that I don't get when running the example manually by hand. In the \examples section of an Rd file, I create a GRanges object, then I call a function with the GRanges object, whose first 2 lines are require(GenomicRanges) annoDF <- as.data.frame(anno) # anno is the GRanges object. and that second line gives: Error in

Hallo, I just installed all needed packages for my project on my PC. But I cannot load all at one time. I now want to load limma. How can I realize the following plan: I want to install for example limma inclusive all needed other sub packages (add-on). Can anyone tell me the corresponding command? Thanks, Corinna Here is the result of the command library(): Pakete in Library

In this post https://stat.ethz.ch/pipermail/bioc-devel/2013-March/004152.html a package author reports that S4 dispatch fails. I can reproduce this with a PkgA (attached; 'intervals' is a relatively light-weight CRAN package) that has DESCRIPTION with Depends: intervals Imports: graphics NAMESPACE: importFrom(graphics, "plot") export("plot")

Hello, Can anyone please suggest any packages in R that can be used to overlay gene expression data on SNP (affymetrix) copy number ? Thanks, Ekta Senior Research Associate Bioinformatics Department Jubilant Biosys Pvt Ltd, #96, Industrial Suburb, 2nd Stage Yeshwantpur, Bangalore 560 022 Ph No : +91-80-66628346 The information contained in this electronic message and in any attachments to this

In checking my vcdExtra package, the following NOTE newly appeared (R-Forge, using R version 3.0.1 Patched (2013-08-20 r63635)) Package in Depends field not imported from: ?gnm? These packages needs to imported from for the case when this namespace is loaded but not attached. In the DESCRIPTION file, I have Depends: R (>= 2.10), vcd, gnm (>= 1.0.3) In NAMESPACE: # we are a vcd

Based on some testing it seems to me that if I have a package with a dataset in /data a Sweave vignette in inst/doc (but no associated pdf file) the vignette loads the data in /data through data(dataset) and I do a R CMD build R will try to build the pdf version of the vignette, but will be unable to find the dataset in data because the package is not yet installed. However, if I do

I have recently upgraded to Ubuntu Gutsy and, for the first time, am using a 64-bit installation. After failing miserably to install R from source, not a problem for me in the past with a 32-bit install, I went the route of using the Debian Etch build. This went smoothly, but I am unable to update my numerous R and BioConductor packages, getting non-zero exit status errors on each package. Is

Full_Name: Colin A. Smith Version: 1.8.0 OS: Mac OS X 10.2.6 Submission from: (NULL) (216.102.90.18) Both Biobase and my package annaffy use S4 classes to define methods for "[". Both packages use the save image method of installation. (See annaffy 1.0.3 in BioC CVS.) Depending on how both packages are loaded, the Biobase definitions seem to be getting masked out: >

Over the last several days, I've been working hard to get all of the Fedora R packages rebuilt against R 4.0 in rawhide (in the F33-R-4 side tag). With the exception of R-biomaRt, R-BSgenome, R-GenomicAlignments, and R-rtracklayer, I believe everything is built and updated to the latest versions. And of those packages, they're all ready to go when Fedora infrastructure is working reliably

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Hi, Is there a mean to automatically choose one version of the 'rbind' function ? By default, R chose the 'rbind' from {base}, i would lke to use the one from {IRanges}... Is it possible to set that using 'par' ? > ?rbind Help on topic 'rbind' was found in the following packages: Package Library IRanges