similar to: Carriage returns and Sweave output

Hi Is it possible to subset an n-dimensional array by a vector of n dimensions? E.g. assume I have > x <- array(1:24, dim=2:4) > x[1,1,2] [1] 7 > dims <- c(1,1,2) I would like a function that I can supply x and dims as parameters to, and have it return 7. Also, I would like to do something like: > x[1,1,] [1] 1 7 13 19 > dims2<- c(1,1,NA) And have a function of x and

Dear all, is there a good way to create SVG plots with R whose elements have titles (tooltips) or act as hyperlinks? I am using the RSvgDevice package, which works great - but it doesn't seem to support the notion that plot objects have titles or are act as hyperlinks, so I am helping myself by giving the objects funny unique colors and then postprocessing the .svg file. I wonder

Hi, I am finding the recently added [1] functionality of embedding raster images into plots on R devices very useful! Thanks to Paul Murrell and others for providing that. I noted that in https://svn.r-project.org/R/trunk/src/library/grDevices/src/devPS.c a macro is defined: #define MAX_RASTERS 64, and consequently, I get Error in grid.Call.graphics("L_raster", x$raster, x$x, x$y,

Hi, when running the following on a fresh R, library("IRanges") annotation showMethods("annotation") Biobase:::annotation showMethods("annotation") I get (see the "^^^^^" marked output at the bottom): > library("IRanges") Carico il pacchetto richiesto: 'IRanges' The following object(s) are masked from package:base :

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I run into following error when using heatmap() for data matrix "xx". Any help is appreciated? "xx" contains many "NA"s. > hv <- heatmap(data.matrix(xx)) Error in hclustfun(distfun(if (symm) x else t(x))) : NA/NaN/Inf in foreign function call (arg 11) Thanks a lot. Yuhong

Hi, I have a set of matrices (MAT.1, MAT.2, ...) and I'd like to perform the same operation on each of them (for simplicity, say . I'm writing a function for this so that it can be repeated for different sets with different numbers of matrices. The matrices have the same number of columns, but do not have the same number of rows. My thought is to loop thru the set. but I'm not sure

Greetings, I have "inherited" a cDNA macroarray dataset that is structured as follows. Three different stressors were tested. For each stressor, there are two treatments (control and stressed). For each treatment, two biological replicates exist, and these are paired (i.e., there is a stressed array for colony A and a control array from this same colony). For one of these samples,

R 2.5.1 on WinXP I'm trying to create new variables in a dataframe called jaw, as powers of jaw$age up to the sixth power, and name them jaw$age.(--the digit corresponding to the power--) Obviously none of these work (silly for me to try, I suppose): for (i in 2:6) { jaw$age.'i' <- jaw$age^i } for (i in 2:6) { jaw$age.i <- jaw$age^i } for (i in 2:6) {

Hi, I'm trying to register my native routines using R_registerRoutines (...). I can compile the code, but the loader cannot resolve the symbol: undefined symbol: _Z18R_registerRoutinesP8_DllInfoPK12R_CMethodDefPK15R_CallMethodDefS3_S6 _ $ nm bgx.Rcheck/bgx/libs/bgx.so | grep R_registerRoutines U _Z18R_registerRoutinesP8_DllInfoPK12R_CMethodDefPK15R_CallMethodDefS3_S6

Deal all, new as I am to developing packages for R-Project, I apologize on beforehand for questions that are too obvious. I am trying to 'add' a PDF document containing some detailed information to a package. The way I understand the Rexts.pdf document, I should add my .PDF document to the /inst/doc/ folder, and links to the files should be build automatically. However, after

Hi, I was checking the source code to the function combn that "generates all combinations of the elements of 'x' taken 'm' at a time.", because I wished to modify it. I have a doubt about a statement. This is the main loop. ._1 <- 1:1 nmmp1 <- n - m + ._1 while (a[1] != nmmp1) { if (e < n - h) { h <- ._1 e <-

I'm working with a genomic data-set with ~31k end-points and have performed an F-test across 5 groups for each end-point. The QA measurments on the individual micro-arrays all look good. One of the first things I do in my work-flow is take a look at the p-valued distribution. it is my understanding that, if the findings are due to chance alone, the p-value distribution should be uniform. In

Dear all, Since my package is based on S4 classes, I would like to know how to add a slot to an existing S4 class without breaking the code of users of my package. Assume the following S4 class: setClass("MyClass", representation(name = "character", type = "character", data = "data.frame" ), prototype(name =

Um texto embutido e sem conjunto de caracteres especificado associado... Nome: n?o dispon?vel Url: https://stat.ethz.ch/pipermail/r-help/attachments/20080208/bf7b4696/attachment.pl

Good day, The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer. > round(2.5) [1] 2 -------------------------------------- Dario Strbenac University of Sydney Camperdown NSW 2050 Australia

I try to sort this dataframe: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [1,] "CM" "BARBY" "INCREASED" " 0" " 2" " 0" " 1" " 1" [2,] "CM" "BARBY" "REDUCED" " 0" " 1" " 2" " 2" " 5" [3,] "CM"

Hi, R 2.5.0 isn't auto-completing paths properly as it used to. E.g. suppose I have: > dir("CEL/choe") [1] "chipC-rep1.CEL" "chipC-rep2.CEL" "chipC-rep3.CEL" "chipS-rep1.CEL" [5] "chipS-rep2.CEL" "chipS-rep3.CEL" Now if I do: ReadAffy("CEL/choe/ch<tab> # => ReadAffy("CEL/choe/chip

Dear all, R on Macports relies on GCC 4.3 to build packages. I find that packages with shared objects that use C++ streams crash R if they're compiled using Macports' gcc43, but work fine if compiled in exactly the same way using Apple-supplied GCC 4.2. Has anyone here had the same issue/know what is causing this problem? Thanks, Ernest

Dear all, I have wrapped a C++ function in an R package. I allocate/deallocate memory using C++ 'new' and 'delete'. In order to allow user interrupts without memory leaks I've moved all the delete statements required after an interrupt to a separate C++ function freeMemory(), which is called using on.exit() just before the .C() call. I am concerned about the