similar to: find points on a graph

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7

Hey guys, if i do a correspondance analysis, e.g.: table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) Library(ca) plot(ca(table)) is there a way that i can see

Hey guys, Does anyone have an example of a REALLY simple shell script in R. Basically i want to run this command: library(MASS) wilcox.test(list1,list2,paired=TRUE,alternative=c("greater"),correct=TRUE,exact=FALSE) in a shell script something like this: #!/bin/bash R library(MASS) for i in *.out do wilcox.test($i,${i/out}.out2,paired=TRUE) >> $i.out done that i can run on a

SocketError in EmailController#correspond getaddrinfo: no address associated with hostname. Please see above, these are the errors i get when i try to email a user on my networking site. Can you help please. Actionmailer address = smtp.vodafone.ie Below is code used for the email controller in apps/controllers/email_controller.rb There doesnt seem to be any code missing. Can someone help with

Hey guys, I'd really appreciate any help. I have a multivariate analysis done, the output of which is: > GraphData <-read.table("eigen.coa") > GraphData V1 V2 V3 V4 1 1 0.371970 0.8552 0.8552 2 2 0.061785 0.1420 0.9972 3 3 0.001211 0.0028 1.0000 4 4 0.000000 0.0000 1.0000 > summary(GraphData) V1 V2 V3

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi I would like to plot the variation of some mean values with time, and have the standard deviation around the mean shaded on the plot. I could not find a way to have the shaded area on the curve with the default R commands, do I need a special package to do that? Or any idea of a way with the default R commands? Many thanks Thomas -- Thomas Loridan King's College email: thomas.loridan

Hi, I've looked through the posts but couldn't find a solution to this. I'd be really grateful if someone could help, I'd like to convert a data file of mutual information that is formatted as a matrix:             TF1    TF2    TF3    TF200... Gene1    0.0    0.2    0.2 Gene2    1.4    0.0    2.8 Gene3    0.3    0.6    1.7 Gene6000.... To a list: Gene1    TF1    0.0 Gene1   

hi, folks: i need to transpose the following data: gene tissue patient1 patient2 patient3..... --------------------------------------------- gene1 breast 10 100 1 gene2 breast 20 200 4 gene3 breast 30 50 5 gene4 breast 40 400 9 ................................ to the

Hello all! I have the following problem with the %in% command: 1) I have a data frame that consists of functions (rows) and genes (columns). The whole has been loaded with the "read.delim" command because of gene-duplications between the different rows. 2) Now, there is another data frame that contains all the genes (only the genes and without duplicates) from all the functions of

Hi all, I have been struggling with this problem for a few days. I have a data table like this: gene rpkm1 diff1 rpkm2 diff2 gene1 23 50 13 120 gene2 111 220 827 1200 gene3 75 998 71 910 And I want to re-format it so that, for each gene, I have a 2x2 contingency table, such as: gene rpkm diff gene1 23 50 gene1 13 120 gene2 111 220 gene2 827

Hello I have two lists of numbers, each list is ~800 numbers long. I want to know if the two lists are significantly different from each other. Could anyone suggest what library in R to use? I think maybe the mann-whitney test, as it is not parametric, but i am unsure if it is suitable as my list of items are so long.So i am unsure which library would suit best. Aaral. [[alternative HTML

I have 2 files containing data analysed by 2 different methods. I would like to find out which genes appear in both analyses. Can someone show me how to do this? _________________________________________________________________ [[trailing spam removed]] [[alternative HTML version deleted]]

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

Hello. I'm having trouble installing rgl. I have a theory as to the problem. First, the error message and session info. > install.packages("rgl") trying URL 'http://probability.ca/cran/src/contrib/rgl_0.81.tar.gz' Content type 'application/x-gzip' length 1636939 bytes (1.6 Mb) opened URL ================================================== downloaded 1.6 Mb *

Hi, this might be basic but can't get it to work and it is hampering my R usage: #the loop is checking variance of rows, and cutting out rows with var>numVec[i] #I define outMat as object names I want to output to (does this make sense? how else #can I define sequential numbered output?) #numVec is numbers I use in the loop head(Counts) AN1 AN2 AN3 AN4 var GENE1

hi, everyone: i have a question on the reshape function. i have the following dataset : gene tissue patient1 patient2 patient3............. _________________________________________________ gene1 breast 10 20 50 gene2 breast 20 40 60 gene3 breast 100 200 300 which i hope to convert to the following format: gene patientID

hi I want to compare two list by its names and get the values of that list. can anybody let me know the syntax of comparing the list by their names using a for loop c.genes<- list() for(i in 1:100) c.genes[[1]]<- geneset(which(geneset == tobecampared[i])) } here geneset is a list and also tobecampared is a list Thank you Ramya -- View this message in context:

Hello: I am a novice R user, but I have been working my way through the manuals / tutorials, ... I have R / Deducer up and running, and know the basics. I want to analyze a microarray (gene expression) dataset. I need to input the data into R as a multidimensional (multi-way) array, something on the order of 15,000 x 3 x 8 x 2 [genes x replicates x time points x treatments] I've

This is an automated email from the git hooks/post-receive script. arrfab pushed a commit to branch main in repository centos/centos.org. The following commit(s) were added to refs/heads/main by this push: new 078b3ae Fixed hour/link for infra sig meeting 078b3ae is described below commit 078b3ae229f5d8770bbc0fcfb079970c3def4551 Author: Fabian Arrotin <arrfab at centos.org>