similar to: Winbind 3.0.25c: Problem joining 3.0.24 domain

I set up a samba 3.0.2 server as member server in a NT4 Domain. Winbind works great and I can "use" the NT Domain users for all I need. At the moment I'm testing different shares with their permissions. The Samba will also be our printserver, so I set up also cups and added the printers to samba with cupsaddsmb - Great tool! . Users could connect and all worked fine. After a reboot

Hallo! after migrating the pdc from nt to samba+ldap my member fileserver doesn't see the groups anymore. I set it up with nss as shown in: http://samba.org/samba/docs/man/Samba-Guide/unixclients.html#ch9-sdmnss getent passwd + group show all user and groups correctly wbinfo -u shows all users correctly, but wbinfo -g show only 2 builtin accounts. I tried without nss only with winbind

Hello! I'm trying join client in samba server. But, get this error: [2008/04/12 12:18:53, 0] utils/net_rpc_join.c:net_rpc_join_newstyle(304) error setting trust account password: NT code 0x1c010002 Unable to join domain PDCSERVER. The password is correct (when i type wrong password the error message changes) and my network is: - Client: 192.168.0.X - PDC Server: 192.168.1.1 - Wireless

I am having difficulty joining my new samba server to my domain. I am replacing an old member server. I am using the same config file with a new netbios name I try 'net rpc join -S my-pdc -W my-domain -U root' and get the following utils/net_rpc_join.c:net_rpc_join_newstyle(304) error setting trust account password: NT code 0x1c010002 Unable to join domain my-domain. I can dynamically

Hi, My PDC is running on 3.0.23d. I have more than 50+ users (Win XP , Linux) connected to it. Today I've downloaded 3.0.25b and wanted to add to domain new server. For a while I was wondering if 3.0.25b can join to elder 3.0.23d but gave it goal. This message I got during joining: /opt/samba-3.0.25b/bin/net rpc join -U user1%pass1 Starting service: samba [2007/07/20 13:02:35, 0]

Hi, I'm settin up a member Server in a samba domain. (both 3.0.24) getent passwd/group shows all user and groups wbinfo -u/g shows user and groups net groupmap list shows all groups correctly Here's the testparm output: Server role: ROLE_DOMAIN_MEMBER [global] workgroup = AAG server string = FILES (%v) security = DOMAIN password server = 192.168.100.72

We have a PDC running Samba Version 3.0.24 while the BDC is running Samba Version 3.0.28a. Both domain controllers are running Gentoo. The problem seems to be a compatibility issue between two versions of Samba. Please see below the error when I tried joining the BDC. [2008/05/12 15:15:25, 0] utils/net_rpc_join.c:net_rpc_join_newstyle(310) error setting trust account password: NT code

Trying to add machine accounts using the following: add machine script = /usr/sbin/useradd -c Machine -d /dev/null -g machines -s /bin/false %u I get the following in the log file on the server prs_mem_get: reading data of size 2 would overrun buffer by 1 bytes. api_samr_set_userinfo: Unable to unmarshall SAMR_Q_SET_USERINFO. api_rpcTNP: samr: SAMR_SET_USERINFO failed. and the following error

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...

Hallo! I installed Samba 3.0.1 on Deb Woody 3.0 with Cups 1.1.19 and joined to an NT4 Domain without problems, after solving the "Umlaut" problem. Unfortunately the System was installed in german... I read a lot in the Samba HowtoCollection and installed the printer following to it step by step. Added the printer driver via APW, then connected from the Client and changed some

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

hi, is this a feature or a bug in conjunction with apple mail. i usually use the feature in imap to not delete the emails, but only mark them as deleted, which is a very usefull feature if you use a emailbox with more people accessing it. Im now trying an SME server installation with dovecot 0.99.10, and when i delete a message, it gets marked as deletet, but as soon as i change the mailbox

Hi, I need help with the management of dovecot, this mean that I want to know when a mailbox is deletet or modfified, and others audit tasks, It's important because I have a problem with a MUA that loose mails and I want know when this happen. Thanks, Roly Morales

Hi. I am trying to configure Samba in Domain security mode. I am on a Sun box running Solaris 9 and Samba 3.0.23. A computer account for this Unix Box is configured in the AD Domain (FAFIDDOM) but I am having issues running net rpc join. I am not planning to use winbind as the samba shares that I want to create are going to be used by ClearCase (Rational Configuration Management Tool). ClearCase

Hello, I have recognized a pretty annoying thing with my Samba-Server: My smb.conf is set, that deletet files go into the dir ".Papierkorb". It works well one one Client, but when the user deletes Files on the other client, a dir called "RECYCLER" appears with the file and some .ini files in it. Is there a way to solve this? Both clients are WinXP, I'm using Samba

I'm trying to migrate a TAS PDC to Samba 3.0.20b on Solaris 9. Trying to use the NT migration guide gets stopped pretty quickly at just trying to join the domain: ---8<----------------------------------------------------------------------------- bash-2.05# net rpc join -S fillager -W LIU -U admin Password: [2005/10/24 00:21:28, 0] utils/net_rpc_join.c:net_rpc_join_newstyle(175) error

Please cc me on replies. My employer recently upgraded to W2K3. I have no control over the employer's set up and limited access to information. Under the old server, everything was working fine. Now I can't mount the shared drive anymore. I'm running Debian sid; samba 3.0.6-3. ################################################ # mount shared_drive cli_negprot: SMB signing is

hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hallo, I have an old samba-cups printserver (debian woody), connected to the domain through winbind,?that I must replace now. I installed a new samba-cups server on a sarge machine. Windbind works, I can get all users and groups. I copied the generic windows postscript driver files as in cupsaddsmb-manpage described to /usr/share/cups/drivers (tried also adobe drivers) Also tried the same