similar to: urgent: winbind doesn't see groups from samba pdc+ldap

Hi, I'm settin up a member Server in a samba domain. (both 3.0.24) getent passwd/group shows all user and groups wbinfo -u/g shows user and groups net groupmap list shows all groups correctly Here's the testparm output: Server role: ROLE_DOMAIN_MEMBER [global] workgroup = AAG server string = FILES (%v) security = DOMAIN password server = 192.168.100.72

I set up a samba 3.0.2 server as member server in a NT4 Domain. Winbind works great and I can "use" the NT Domain users for all I need. At the moment I'm testing different shares with their permissions. The Samba will also be our printserver, so I set up also cups and added the printers to samba with cupsaddsmb - Great tool! . Users could connect and all worked fine. After a reboot

Hi all, How can I convert factor like this: > str(repo) 'data.frame': 1000 obs. of 1 variable: $ AAA: Factor w/ 1000 levels "AAT","AAC",..: 1 2 3 4 5 6 7 8 9 10 ... > print(repo) AAA 1 AAA 2 AAT 3 AAC ... into to simple vector > str(new_repo) chr [1:100] "AAA" "AAT" "AAC" "AAG" "ATA" "ATT"...

Dear all, I tried to find index in repo given a query with this: > repo <- c("AAA", "AAT", "AAC", "AAG", "ATA", "ATT") > qr <- c("AAC", "ATT", "ATT") > which(repo%in%qr) [1] 3 6 Note that the query contain repeating elements, yet the output of which only returns unique. How can I make it

hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi guys, I use R 2.6.2 and Windows XP. I’ve got the following question: I wrote a lot of text into the margin of a plot. When I use the “jpeg”-function, only a little part of the margin text is displayed in the final jpeg? Any ideas to change it? Source-Code: datenbankdaten<-data.frame(LETTERS[1:20],

Dear all, I have a repository file (let's call it repo.txt) that contain two columns like this: # tag value AAA 0.2 AAT 0.3 AAC 0.02 AAG 0.02 ATA 0.3 ATT 0.7 Given another query vector > qr <- c("AAC", "ATT") I would like to find the corresponding value for each query above, yielding: 0.02 0.7 However, I want to avoid slurping whole repo.txt

I have a machine with a running samba 3.0.24 with winbind. After an update to 3.0.25c I couldn't connect from win clients. So I first tried to rejoin and got some errors about trust account problems - sorry didn't save them. Then I deletet the account the tried a fresh join from the machine: net rpc join -Uaga -Waag -Serde Password: [2007/08/23 11:13:39, 0]

We are happy to present the agenda for the Asterisk conference at the Atlanta Marriot Century Center - Astricon 2004. Previously, you could only find the tutorials agenda on the web site, but now we've added information on the conference day as well. The Astricon Conference starts with one day of in-depth tutorials on many levels, both for the new Asterisk user and for the one that considers

Hello LLVMdev, I’m using LLVM to do static analysis exclusively (without any code generation). To implement this analysis, I’m using multiple address spaces to disambiguate the purpose of the pointed memory. Since address spaces never alias in my model, I set on to implement an alias analysis pass that would exactly provide this information, as I’m seeing a couple of otherwise dead store that

Dear All I would really appreciate some help with a script which a colleague wrote for me, but I am having problems running (and have not been able to contact my colleague). The script is designed to compare the area of suitable habitat in binary projections of a large number of species current and future distributions, and create an excel file detailing the total area suitable in the

Hallo, I have an old samba-cups printserver (debian woody), connected to the domain through winbind,?that I must replace now. I installed a new samba-cups server on a sarge machine. Windbind works, I can get all users and groups. I copied the generic windows postscript driver files as in cupsaddsmb-manpage described to /usr/share/cups/drivers (tried also adobe drivers) Also tried the same

Hi! Just today, I managed to attach my Win98 client at home to my remote network which is controlled by a Linux samba 2.0.5a server. The TCP/IP connection is working just fine, I'm able to access all services like ftp, telnet, ... The Win98 client is connected to the network using the DialUp-Network. The option "log on to remote network" is activated and as far as I can conclude

Hello everybody! I’m trying to define the optimal number of surveys to detect the highest number of species within a monitoring season/session. To do this I want to run all the possible combinations between a set of samples and to calculate the total number of species for each combination of 2, 3, 4 …n samples events, so that at the end I will be able to define which is the lowest number of

Hi, I am wondering if you may be able to help me. I have an application that has been developed by a third party and is being used in some field locations. My challenge is that I have no way of independently testing the product across the WAN at this point. All testing they have proposed required manual intervention and subjective analysis. I am not comfortable deploying the solution in this

Hi, first of all, my name is Karsten and I am fairly new to xen. A former colleague of mine has set up a xen dom0 with 4 virtual machines runnig on it. A few months ago this colleague left the company. Last week our office Building has been hit by a lightning wich resulted in an power blackout. After the power went back again, the system booted and all but one of the virtual machines went

Dear list, I am battling with rather grave performance issues in the 42052 build of XCP 1.0. Specifically, this concerns disk IO both on the host and in the VMs. I have tested the connectivity to the NFS/iSCSI server that backs the whole platform (Nexenta, SSD ZIL/l2arc, striping over 9 5-disk zraid1), and from a clean Ubuntu install, I am able to saturate the network both over NFS and iSCSI

Dear all, I have a problem with the function read.xls from the gdata package, error message see below. Two examples: First, I try to read my data, which does not work; Secondly, I tried the example code/data with the Iris data, which worked Any idea? Thanks, Lars > path<-"I:/subProjects/bh/HPGD/" > > setwd(path) > > xls <- "Platten_Liste_090421.xls"

Dear all, I have ended up in a situation where CentOS 5.0 does not work for me - is it feasible to downgrade from 5.0 to 4.6 while the servers are up, or would the most sensible option be to just reinstall from scratch? Thanks in advance + best regards Jan