similar to: Accessing shares

Hi all! Do anybody has a full working environment using externip on an asterisk box behind a nat? I tried with two diferent boxes (Elastix-1.4.24 e Trixbox-1.4.22-3)and the asterisk do not replace neither contact, neither sdp headers info with the externip informed on sip.conf general parameters. I used these two statements: externip=XXX.XXX.XXX.XXX localnet=192.168.200.0/255.255.255.0 Do

Hi all, I try to test a linear slope using offset. I have: > m2 <- glm(Y~X*V) > summary(m2) Call: glm(formula = Y ~ X * V) Deviance Residuals: Min 1Q Median 3Q Max -2.01688 -0.56028 0.05224 0.53213 3.60216 Coefficients: Estimate Std. Error t value Pr(>|t|) (Intercept) 1.3673 0.8476 1.613 0.119788 X

Hi im trying to configure centos to run as a dhcpd daemon but it simply doesnt work I'm using the default configuration file from dhcdp (and tried multiple alternatives). problem is that pxe clients do not aquire dhcp addresses in the log i can see that there are 3 or 4 dhcp offers per boot atempt but no dhcp requests anyone? i'm going crazy here... .i've tryed 3 diferent

Dear all, Sorry for the previous email. I had a wrong example output: Input: Start End 440 443 380 443 290 468 CORRECTED Desired output: Start End 290 380 380 440 443 468 Best regards, João Fadista [[alternative HTML version deleted]]

Hello, I?m spanish student, and I?m making the finish project of computer science. I?m working in R and I need create a Interface which allow me select diferents execution options (similar to a menu). Is posible to create this menu,or interface, with R? or I have create this interface with other language. Thank you very much, and I hope that you understand my english. -- View this message in

On Thu, 2006-03-02 at 11:42 -0600, Jordan Novak wrote: > Does anyone have a way to do wake calls? > > > > Jordan Novak > > Communications Technician > > Logistics Health Inc. You could use cron and /var/spool/asterisk/outgoing scripts to dial numbers, etc... > Can you elaborate, I am fairly new to Linux and a phone guy to boot. I am looking for a way for the

Switch is only tagging the vlan packets. Once the PC loads the vlan aware driver ("client") it will be able to read tagged packet for the vlan which PC has been configured to use. Nothing to be done on the switch. W -----Original Message----- From: Joao Pereira [mailto:joao.pereira@fccn.pt] Sent: Thursday, March 02, 2006 1:15 PM To: Wojciech Tryc; asterisk-users@lists.digium.com

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Cisco phones act a as a switch. If you do not use the CDP protocol to "tell" the phone it needs to be in a special VLAN (802.1q) then it will just use the access port settings on the switch, and, also allow the PC connected to the 2nd Ethernet port to have access to the network. However, if you have an all cisco powered network, with all cisco phones, I could advise you to use the CDP

Hello all, I'm trying to calculate the Maximum likelihood of individuals to get the ancestry. I mixd 3 populations 15 generations in proportion of 20% 20% 60% when each population sorce have diferent genome (0 1 and 2) with frequencies for each one. So now i have individuals looks like 0 0 2 1 1 2 0 ..... and i don't now how to calculate the mle although i try to figure out from the

I wonder whether R provides an interface to access miRecords data. Particularly, I am looking for extracting humans miRNA and target genes sequences. All such information is stored in there in a set of structured web site pages (http://mirecords.umn.edu/miRecords) I would greatly appreciate any suggestion even about other data bases from where it is possible to get the same sort of data. I had a

Hi, par(mfrow = c(2,2)) will create a 2x2 window that I can use to plot 4 diferent figures in: [plot1 plot2] [plot3 plot4] But how can do 3 so that the bottom spans the width of the upper two: [plot1 plot1] [p l o t 3] Is this possible in R? -- View this message in context: http://r.789695.n4.nabble.com/multiple-plots-in-single-frame-2-upper-1-lower-tp3679574p3679574.html Sent from the R

I said: > # MSS CLAMPING > # Your kernel must have CONFIG_IP_NF_TARGET_TCPMSS set. > > I''ve activated the option, but to no result watsoever. > Checked my kernel config, and it states that CONFIG_IP_NF_TARGET_TCPMSS is a > loadable module, that should be loaded on demand. > Simon said: > Did you try adding it to /etc/shorewall/modules ? Actually, no I

I guess my subject says it all. But I loaded a dataset in spss and used the foreign package to read and save it in R. Running an anova (using the aov command) gives a different F and p value in R than it does in SPSS. ANy idea what is going on? -- View this message in context: http://n4.nabble.com/R-ANOVA-gives-diferent-results-than-SPSS-tp1477322p1477322.html Sent from the R help mailing list

Humm whats is the diferent? Em 16/12/2015 14:19, "Annus Fictus" <annusfictus at gmail.com> escreveu: > CDR-STATS is for reporting. > > A2Billing is for billing... > > Regards > > El 16/12/2015 a las 11:15, Vitor Mazuco escribi?: > >> Hi everyone! >> >> I'm trying to install CDR-Stats (cdr-stats.org), but it very difficult. >>

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Hi list, i have a samba4 AD server working, and squid 2.7 auth internal...so i need change the auth of squid to my samba4 server....i search in google but information is incomplete and diferent...any official site, wiki or user experince to get information about? regards and thanks -- Administrador de Redes Nodo Provincial ESILT OS: Debian 7.5 wheezy

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Dear all, I would like to know if there is any R package that uses a sliding window approach to assess statistical significance out of my data. My data is composed of DNA sequences (of variable length) that are mapped to a genome with a determined score of alignment. So, I want to see if I can find more tags in a given region of the genome as opposed to finding them by chance. In this sliding