similar to: Windows interacting with SAMBA share

I have re-labeled tick marks on the x axis. The problem is that by using axes=FALSE, the axes disappears and when they are called back using axis(side=1)..etc. the axis on sides 1 and 2 do not meet at the bottom left corner of the graph. I would also like to have the 3rd and 4th axes in there as well, all meeting in their respective corners. par(mfrow=c(1,2)) gut<-c("Full",

Does anyone know of a cross browser solution to print a page/url after a user clicks a button? Currently, I''m using a "hidden" iframe to do my bidding. But from my experience, IE requires that the iframe''s src attribute be set initially to the url, in order for the page to open properly. I wasn''t able to add the iframe to the page dynamically, either. So

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

hello, I have got some trouble with R functions nlm(), nls() or optim() : I would like to fit 3 parameters which must stay in a precise interval. For exemple with nlm() : fn<-function(p) sum((dN-estdata(p[1],p[2],p[3]))^2) out<-nlm(fn, p=c(4, 17, 5), hessian=TRUE,print.level=2) with estdata() a function which returns value to fit with dN (observed data vactor) My problem is that only

I''ve been trying to implement acts_as_ferret in my latest project and ran into a snag. If I do a search for ''auditor state'' then the search works perfectly. If I include a stop word, as in ''auditor of state'', then I get no results. I''d prefer not to set stop words to nil and index everything. The solution, that I have yet to attempt, is to use

Not sure how much this will interest people but I don''t have a blog so I''m posting something I threw together today cause I think it might be useful. In what little free time I have I''ve been wanting to put together a Rails/Ferret based restful dictionary. So I finally got a chance to get started today so the first thing I wanted to do was implement a metaphone

I''m having issues with page caching in Rails 1.1.6 where it''s not always putting a .html extension at the end of the cached files (so I end up with files like 122.21 instead of 122.21.html). Then the next time it is served up via the web server (mongrel or apache) Firefox treats it as a binary file. I can''t find a fix for this so I was hoping there would be a

I''m trying to highlight keyword snippets using the highlight method of the results returned from find_by_contents (the actual models), but always come up with an empty array. Any ideas what could be going wrong? -- Posted via http://www.ruby-forum.com/.

I would like to import "tif" images in R and I do not find any function that can do that. In Matlab there exists the function "imread" that can read the most known images format. Does a similar function exist for R ? Thanks in advance -- Herve CARDOT ____________________________________________________________ Unite Biometrie et Intelligence Artificielle, INRA Toulouse BP

Hello, tried to install Brothers In Arms: Earned In Blood in Hardy, Wine 1.1.18, and it gets through the entire install, then asks me to reboot. When i click yes, the window disappears. But nothing happens. I open it again to find the same prompt right in front of my face. I've tried wineboot in the Terminal, tried even restarting ubuntu itself. But it always comes up with that same

Does anybody knows how can I display the memory usage in R? I'd like to know how much RAM R is using to store a data set that I'm reading, is it possible? Thanks in advance, Beatriz -- View this message in context: http://r.789695.n4.nabble.com/display-memory-usage-tp4175898p4175898.html Sent from the R help mailing list archive at Nabble.com.

Tried with a windows 2008 r2 AD master brouser is available, microsoft is migrating to what option? 2016-06-20 18:49 GMT+02:00 Trenta sis <trenta.sis at gmail.com>: > First of all, thanks for you answer. > > "Problem" is that our users are using this feature, and if we can keep > this should be the best option to ensure that our user have detecte any > difference

On Fri, 10 Feb 2017 14:29:00 +0100 Patrik <alabard at gmail.com> wrote: > *Same result:* > Calling samba-tool dns for SRV _ldap._tcp.Default-First-Site-Name._ > sites.ForestDnsZones.ac.patrikx3.tk server.ac.patrikx3.tk 389 (add) > Calling samba-tool dns add -k no -P ['192.168.78.20', > 'ac.patrikx3.tk', >

I'm probably misunderstanding something in "Writing R Extensions" version 1.0.0. In the chapter on the R API, section 4.7, it is stated that the functions listed in R_ext/Linpack.h are available to users' Fortran code. I am developing a developing a library of ode solvers, based on lsoda and ddassl, and which in turn call some routines from linpack and double precision blas. I

Hi, I'm migrating samba 3 nt domain (openldap + samba) to samba 4 AD, and we detected taht one of features, master browser is not working in samba 4 AD. I have searched some info and I have found: https://wiki.samba.org/index.php/FAQ " Why is Network Neighbourhood empty or does not show all machines in an Samba AD environment? The master browser code in smbd does not collect names

Am 24.10.2016 um 15:25 schrieb Gandalf Corvotempesta: > 2016-10-24 14:47 GMT+02:00 Michael Seevogel <ms at ddnetservice.de>: >> If your server OS supports newer Dovecot versions then I would highly >> suggest you to upgrade to Dovecot 2.2.xx (or at least to the latest 2.1) and >> set up Dovecot's replication[1] feature. > > Are you talking about the new server

I am quite unfamiliar with DTrace (and even more with Solaris/Linux/other) kernel internals. I recently had to help look into an issue where an application apparently sent a UDP packet, but it did not appear on the wire, nor did snoop(1)ing the interface show it, so the assumption is that it was lost (or misdirected) somewhere in the IP stack. We did use Dtrace with syscall::sendto:entry/exit to

I''m wondering if anyone has built a Capistrano task that will deploy mongrel either standalone or along with a rails app. I''ve been looking at possibilities for doing this but still new to using both having switched from using FCGI+Lighty and deploying by hand. Thanks, Curtis

I''m trying to figure out how to clear the for a worker from my controller. In my aysnc_xxx process I set cache[key]. However, I don''t see an easy way to clear the cache from a controller with invoking something on the worker. What I was looking for was something like MiddleMan(:worker_name, :worker_key_name).cache[key]= Is there something like that and I''m just

Just run some samba as file server, or perhaps you can even just run nmbd on another host than on your DC. That host running nmbd will participate to browsing election, it should win election if you ask for it in smb.conf. Only DC won't appear in network neighborhood, which is not an issue as even your users loves waste your company time in searching in network neighborhood, they have nothing