Displaying 20 results from an estimated 300 matches similar to: "[Fwd: Re: [K12OSN] Re: [Lrlug-discuss]emergency....file/directory recovery]"
2002 Jun 03
2
Re: [Lrlug-discuss]emergency....file/directory recovery
We have had another instance of this.....
since I am forwarding to other lists, "this" involves a lost file, due
to accidental deletion.
in this case, we had a backup, but from the backup time, till deletion
time, a lot of data had been lost.
So, we have not enough disk space to do hourly backups,
novell allowed recovery of a lost file like this,
so:
is there a filesystem that we
2006 Aug 01
2
Samba/ldap install script from k12osn perl problems
There has been some very good work by a few people over in k12osn for
setting up a SAMBA PDC/BDC environment.
Thing is their scripts are for Fedora core 3.
There are instructions on how to get things to go step by step instead
of use the Fedora-based script, so I gave it a try.
Step 1 is to get apt running and everything current. I assumed yum would
do instead.
step 2 has:
*Installing CPAN
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2001 Sep 27
2
IF MEMBER OF "GROUP" THEN
yes, we are using %g in the mapping of primary group based f drives, but
these scripts I want to run I don't want to base on primary group.
-----Original Message-----
From: Mike Rees [mailto:samba@glanymor.carms.sch.uk]
Sent: Thursday, September 27, 2001 5:40 AM
To: barry@arhosting.com
Subject: Re:IF MEMBER OF "GROUP" THEN
Barry
You can specify the file that is executed when a
2002 Jul 16
0
Rsync windows to linux is hanging
Hello,
I've looked through all the postings and can't seem to find an answer to
my delema. I have tested this on an XP and win2k box and get the same
results. I'm trying to rsync a fairly large directory (approx. 1.6 GB)
from a windows machine to a linux box for backup purposes. The process
hangs at the same point everytime. When I try to rsync smaller portions
of the same large
2004 Feb 15
6
Rooted system
Howyd all? Seems that I have been routed. Possibly
by a physical B&E, but who knows? Probably some
of you do.... anyways, some politically sensitive
email was deleted from a user account and the
line
low -tr &
inserted into my .xinitrc .
Duncan (Dhu) Campbell
2009 Sep 17
4
Limit rsync running time
Hi
I'd like to rsync a large amount of data over a slow connection,
but only during night hours. I couldn't find a parameter that limits
the time that rsync is running, only the timeout on idle time.
I guess the way to go would be to start rsync, get the process
ID and kill the process later on.
Has anybody already written a bash script that would do something
like that? Are there other
2013 Aug 16
4
Restoring deleted files.
Hi,
is it possible to Restore files deleted with " rm rf " from ext4 or
ext3 filesystem by mistake.
Regards
Ahmad
2003 Aug 28
4
compromised server
I have a server that has been compromised.
I'm running version 4.6.2
when I do
>last
this line comes up in the list.
shutdown ~ Thu Aug 28 05:22
That was the time the server went down.
There seemed to be some configuration changes.
Some of the files seemed to revert back to default versions
(httpd.conf, resolv.conf)
Does anyone have a clue what type of
2003 Apr 14
0
modifying password on W2K PDC from Linux (samba 2.2.7-4.8.0)
On May 1st, Chuck Sullivan posted the following:
https://listman.redhat.com/pipermail/k12osn/2003-March/007755.html
No mention was made of /etc/pam.d/passwd, which is what I think we need
to set to enable a user to change their domain password. Our current
settings are:
/etc/pam.d/passwd:
#%PAM-1.0
auth required /lib/security/pam_stack.so service=system-auth
auth sufficient
2005 May 18
1
OS X Server and Duplication
One question and a comment---
Is it possible to setup a G4 X Server into a duplicating server for my k12 LDAP Server?
If not, what are the steps to creating a duplication server for my LDAP server using a PC.
I am fairly new to LDAP, and as I play around with it more I am understanding the way it functions. But I am a bit confused about duplication server. As I understand it, a duplication
2004 Jun 12
2
Hacked or not appendice
Hi all again,
I must add, there are no log entries after June 9, 2004. "LKM" message first
apeared June 8, 2004, after this day, there is nothing in /var/messages,
/var/security .....
How could I look for suspicious LKM module ? How could I find it, if the
machine is hacked and I can not believe "ls", "find" etc. commands ?
Peter Rosa
2008 Apr 29
24
recovering data from a dettach mirrored vdev
Hi,
my system (solaris b77) was physically destroyed and i loosed data saved in a zpool mirror. The only thing left is a dettached vdev from the pool. I''m aware that uberblock is gone and that i can''t import the pool. But i still hope their is a way or a tool (like tct http://www.porcupine.org/forensics/) i can go too recover at least partially some data)
thanks in advance for
2005 May 28
2
Re: Demonizing generic Linux issues as Fedora Core-only issues -- WAS: Hi, Bryan
Even I've left this thread.
I guess we're all waiting for Lee to turn Blue. ;->
Or is it Red (Hat)? ;->
Okay Lee, we all agree, Red Hat makes stupid decisions, adopts buggy software - especially the kernel and Red Hat is to blame for the decisions in the kernel, and also stupidly backports fixes instead of adopting newer versions with the fixes.
And there is absolutely no need for
2006 Aug 29
2
Ext3 emergency recovery
I have a damaged Ext3 filesystem which fsck has not been able to
recover. If I try to mount it, I get a message like this in dmesg:
EXT3-fs error (device sda1): ext3_free_blocks_sb: bit already
cleared for block 2370866
If I try fsck on it, I get a series of messages like this:
Inode bitmap for group 0 is not in group. (block 0)
Relocate<y>?
Up to group 95. Some say
2002 Sep 18
1
Re:emergency .. system crash recovery!
Have you had any luck with recoverin ghte ext3 partition?
I have the same problem and I have found no literature on the web whatsoever...
Please if you have found a solution, let the world know...
-Daniele
2002 Jul 14
1
emergency .. system crash recovery!
I am having some trouble with an ext3 partition, getting the following error
when i go to fsck the partition:
fsck.ext3: Bad mgic number in superblock while opening /dev/sda2
I tried the -b 8193 option, to no avail. Can anyone out there help me
recover this partition??
----
Michael B. Weiner
Senior Systems Administrator/WebOps
AmericanGreetings.com
Three American Road, Cleveland, OH 44144
2010 Dec 09
0
XEN Server#Reset network settings after emergency mode recovery
Hi Everyone,
I am desperately looking for some help from community, I am having issues
with one of the xen server hosts and they can not be recovered from
Emergency mode as they are not able to talk to pool master. I am rebuilding
server every time i came across this situation, there have to better way to
recover XEN host from emergency mode.
I am using Citrix XenServer 5.6 on Dell hardware, Is
2008 Apr 04
2
Quick Help, Anyone? EMERGENCY
Hi,
I have a disk crash on an 2006 vintage Asterisk box that has a g729
license from Digium.
I have been able to re-install from media on the same chassis.
Reactivation is in progress.
Good so far. . .
HOWEVER, I cannot locate my g729 files for the 'digits' portion of
the "sounds".
I only need the ten digits 0.g729 1.g729 . . . 9.g729
Can some kind person zip them up and
2006 May 23
0
HVM: Emergency Management Services for W2K3 under Xen with HVM?
It''d be nice to be able to use the "Emergency Management Services" for
Windows 2003 under Xen.. apparently, to use them, however, the BIOS has to
support serial redirection. Is there any way to get the BOCHS bios to
support serial redirection? I haven''t been able to find anything.
Thanks!
------------------------------------------------------------------------
|