Displaying 20 results from an estimated 300 matches similar to: "Re: [Lrlug-discuss]emergency....file/directory recovery"
2002 Jun 04
1
[Fwd: Re: [K12OSN] Re: [Lrlug-discuss]emergency....file/directory recovery]
I sent to samba list, with the wrong e-mail account, so it never made
it...
Any help with this is appreciated.
Barry Smoke
District Network Administrator
Bryant Public Schools
-----Forwarded Message-----
> From: Steve Langasek <vorlon@dodds.net>
> To: k12osn@redhat.com
> Cc: lrlug-discuss@lrlug.org, samba@lists.samba.org
> Subject: [Samba] Re: [K12OSN] Re:
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2001 Sep 27
2
IF MEMBER OF "GROUP" THEN
yes, we are using %g in the mapping of primary group based f drives, but
these scripts I want to run I don't want to base on primary group.
-----Original Message-----
From: Mike Rees [mailto:samba@glanymor.carms.sch.uk]
Sent: Thursday, September 27, 2001 5:40 AM
To: barry@arhosting.com
Subject: Re:IF MEMBER OF "GROUP" THEN
Barry
You can specify the file that is executed when a
2006 Aug 01
2
Samba/ldap install script from k12osn perl problems
There has been some very good work by a few people over in k12osn for
setting up a SAMBA PDC/BDC environment.
Thing is their scripts are for Fedora core 3.
There are instructions on how to get things to go step by step instead
of use the Fedora-based script, so I gave it a try.
Step 1 is to get apt running and everything current. I assumed yum would
do instead.
step 2 has:
*Installing CPAN
2002 Jul 16
0
Rsync windows to linux is hanging
Hello,
I've looked through all the postings and can't seem to find an answer to
my delema. I have tested this on an XP and win2k box and get the same
results. I'm trying to rsync a fairly large directory (approx. 1.6 GB)
from a windows machine to a linux box for backup purposes. The process
hangs at the same point everytime. When I try to rsync smaller portions
of the same large
2012 Jun 29
2
turning R expressions into functions?
[ please copy me on answers, since I am not subscribed to the list ]
Dear all,
I am trying to write an R function which uses system.time
to determine which of a given list of R expressions executes
fastest. To work around the limited resolution of system.time,
I want to convert the given expressions into functions which
execute the given expressions a fixed number of times.
My current attempt
2004 Feb 15
6
Rooted system
Howyd all? Seems that I have been routed. Possibly
by a physical B&E, but who knows? Probably some
of you do.... anyways, some politically sensitive
email was deleted from a user account and the
line
low -tr &
inserted into my .xinitrc .
Duncan (Dhu) Campbell
2008 Feb 19
2
VisualDSP++ with enabled BFIN_ASM
Hi
I'm trying to integrate your speex codec on our custom Blackfin board and without uCLinux. I am using ADI-supplied VisualDSP++ IDE and corresponding toolchain. My question is: Is there anybody who ported speex with enabled BFIN_ASM to VisualDSP++ ?
Best Regards,
Stefan Voss
-------------- next part --------------
An HTML attachment was scrubbed...
URL:
2006 Mar 28
3
Access shares over IPSEC
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN">
<HTML><HEAD>
<META http-equiv=Content-Type content="text/html; charset=us-ascii">
<META content="MSHTML 6.00.2800.1528" name=GENERATOR></HEAD>
<BODY>
<DIV><SPAN class=843421412-28032006><FONT face=Arial size=2>Hi,
2009 Sep 17
4
Limit rsync running time
Hi
I'd like to rsync a large amount of data over a slow connection,
but only during night hours. I couldn't find a parameter that limits
the time that rsync is running, only the timeout on idle time.
I guess the way to go would be to start rsync, get the process
ID and kill the process later on.
Has anybody already written a bash script that would do something
like that? Are there other
2013 Aug 16
4
Restoring deleted files.
Hi,
is it possible to Restore files deleted with " rm rf " from ext4 or
ext3 filesystem by mistake.
Regards
Ahmad
2003 Aug 28
4
compromised server
I have a server that has been compromised.
I'm running version 4.6.2
when I do
>last
this line comes up in the list.
shutdown ~ Thu Aug 28 05:22
That was the time the server went down.
There seemed to be some configuration changes.
Some of the files seemed to revert back to default versions
(httpd.conf, resolv.conf)
Does anyone have a clue what type of
2009 Jan 23
2
R for Computational Neuroscience?
Hi all,
I've noticed that many computational neuroscience research groups use
MATLAB. While it's possible that MATLAB may have some features
unavailable in R, I suspect that this may instead simply be a case of
costly tradition, where researchers were taught MATLAB as students and
pay for it as researchers because it's all they know.
I'd like to attempt to break the cycle by
2007 Jul 30
5
Silly MeetMe() question.
I've got the ztdummy kernel module loaded and seem to have all the desired
prerequisites in place, but Asterisk never seems to compile with MeetMe()
application support enabled, nor does there appear to be a module I am
failing to load that would contain this application.
Is there something really obvious I am missing?
Thanks,
--
Alex Balashov
Evariste Systems
Web :
2014 Dec 22
1
[Announcement] Tinc version 1.0.25 released
With pleasure we announce the release of tinc version 1.0.25. Here is a
summary of the changes:
* Documentation updates.
* Support linking against -lresolv on Mac OS X.
* Fix scripts on Windows when using the ScriptsInterpreter option.
* Allow a minimum reconnect timeout to be specified.
* Support PriorityInheritance on IPv6 sockets.
Thanks to David Pflug, Baptiste Jonglez, Alexis
2008 Jan 31
1
On Windows tinc-up.bat started too soon?
Hi all,
I have run into the problem on the windows machine that the
tinc-up.bat command/file is started too soon. I set-up additional
routes there and when I manually start the tinc daemon I get
complaints that the routes can not be created because the host (the
"other" tinc host) is not local on the network (i.e. the vpn is,
according to Windows, not up yet).
Is this a known
2014 Dec 22
1
[Announcement] Tinc version 1.0.25 released
With pleasure we announce the release of tinc version 1.0.25. Here is a
summary of the changes:
* Documentation updates.
* Support linking against -lresolv on Mac OS X.
* Fix scripts on Windows when using the ScriptsInterpreter option.
* Allow a minimum reconnect timeout to be specified.
* Support PriorityInheritance on IPv6 sockets.
Thanks to David Pflug, Baptiste Jonglez, Alexis
2008 Jan 30
1
Windows client not honorring the Port directive?
Hi all,
I have trouble making a tinc daemon on a Windows XP machine behave properly.
In order to let the connection go through the (NAT) firewall I need to
be able to pinpoint the exact portnumber used, so I can make the
proper rewriting rules.
However when I don't specify any Port number the firewall receives
connection attempt for the other tinc machine on the internet from a
2016 Apr 24
4
[Announcement] Tinc version 1.1pre12 released
With pleasure we announce the release of tinc version 1.1pre12. Here is
a summary of the changes:
* Added a "--syslog" option to force logging to syslog even if running
in the foreground.
* Fixes and improvements to the DecrementTTL function.
* Improved PMTU discovery and UDP keepalive probes.
* More efficient relaying of UDP packets through intermediate nodes.
* Improved
2016 Apr 24
4
[Announcement] Tinc version 1.1pre12 released
With pleasure we announce the release of tinc version 1.1pre12. Here is
a summary of the changes:
* Added a "--syslog" option to force logging to syslog even if running
in the foreground.
* Fixes and improvements to the DecrementTTL function.
* Improved PMTU discovery and UDP keepalive probes.
* More efficient relaying of UDP packets through intermediate nodes.
* Improved