Displaying 20 results from an estimated 10000 matches similar to: "display memory usage"
2011 Dec 05
3
iterative variable names
Hi,
I'm trying to assign iterative names to variable, but all my attempts have
failed. I have a loop, and for every iteration, I need to create a variable,
and I'd like to name them iteratively, such as:
for(i in 1:10)
{
x_i <- c(values)
}
I need it to return ten variables: x_1, x_2, ..., x_10
How can I do it?
Thank you very much!
Beatriz
--
View this message in context:
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
--
View this message in context:
2011 Dec 07
2
reading partial data set
Hi all,
I'm trying to read a data set into R, but the file is messy, so I have to do
it partially. The whole data is in a .txt file, and the values are separated
by a space. So far ok. The problem is that in this file, not all the lines
have the same number of elements, and the reading stops. And I loose the
reading of the previous lines.
ex. of data set:
11 12 13
21 22 23
31 32
2013 Aug 06
2
data.frame
Hola Javier,
si, y es un factor de Y. Pero ya entendí lo que tenía mal, me falta
convertir Nt a valores de geodata antes de hacer el plot, es decir:
date<-as.geodata(Nt)
plot.geodata(date)
Con relación a la actualización de mi versión de R, no me he animado porque
he tenido problemas con paquetes que no tienen las actualizaciones y no me
corren bien.
Gracias y saludos
Beatriz
2013/8/6
2013 Jul 16
1
Ordenar data.frame
Hola, Beatriz:
Buscando en ?order derivé en arrange, y al final es como resolví:
arrange(my.df, col1, desc(col2))
Con order no conseguía el orden descendente, pues me daba error al intentar hacer order(-my.df$col1)
Gracias.
Eva
________________________________
De: Beatriz Martínez <mtnezb@gmail.com>
CC: r-help-es <r-help-es@r-project.org>
Enviado: Martes 16 de julio de 2013
2012 May 01
1
error bars for a barchart
Hi
I have the following barchart to which I want to add error bars.
library(lattice)
barchart(Change~fTreat,groups=Process,change,
auto.key=list(points=FALSE,rectangles=TRUE),
panel=function(x, y,...){
panel.barchart(x,y,origin = 0,...);
panel.abline(h=0,col="black",...);
}
)
I have tried
2012 May 07
1
How can I brake a label in two lines when using expression()?
I making an xyplot and the y label is too long and needs to be in two rows, but when I brake it there is a huge gap between the last text string and the expression, and I can't get rid of it. Any ideas?
Data:
structure(list(Temp = c(8L, 8L, 8L, 8L, 8L, 8L, 12L, 12L, 12L,
12L, 12L, 12L), CO2 = c(380L, 380L, 380L, 750L, 750L, 750L, 380L,
380L, 380L, 750L, 750L, 750L), Treat = structure(c(3L,
2012 Nov 06
2
Fwd: barchart con abline en lattice
Perfecto! muchas gracias Carlos; la verdad que estuve un buen rato
intentándolo, pero aún no comprendo la estructura de lattice, así que
modificaba cosas un poco al tuntun.
Tengo otra cuestión un poco más controvertida, no sé si este será el foro
adecuado para proponerla o supondrá un debate innecesario....
Como os decía, acabo de iniciarme en R, y estoy explorando las opciones de
visualización.
2013 Oct 29
2
Hoy reunión del "Grupo de Usuarios de R de Madrid - martes 29-octubre"....
Hola Beatriz,
Si me pasas el *.md lo subo a un Dropbox y si no es muy grande lo subo a
R-Hispano (linkándolo a la agenda)....
Saludos,
Carlos.
El 29 de octubre de 2013 15:56, Gregorio R. Serrano
<grserrano@ccee.ucm.es>escribió:
> Hola.
>
> ¿Nos podemos descargar el material de alguna parte antes de ir?
>
> Gracias
>
>
> El 29 de octubre de 2013 14:58, Beatriz
2004 Sep 25
4
Upgrade 20040914.
Hello,
I made a "wine" upgrade from 2003121 to 20040914. I then installed a
program "EasyBridge" that worked perfect with the 2003121 version. The
installation was without any problems, and at the end of the
installation the program started automatically, also withouth problems.
But when I later on recall the program with "wine EasyBridge.exe" I get
the
2013 Feb 01
4
Scrapping con R
Buenas tardes a todos:
No sé si alguno de vosotros sabe si con R es posible buscar una palabra en
una web (por ejemplo, buscar "Alicante" en www.lasprovincias.es) y que,
cada vez que lo encuentre, vaya almacenado las urls en un data.frame
gracias de antemano!
--
Beatriz Martínez
[[alternative HTML version deleted]]
2010 Apr 30
2
drop last character in a names'vector
Hi, i have a vector filled with names:
[1] Alvaro Adela ...
[25] Beatriz Berta ...
...
[100000] ...
I would like to drop last character in every name.
I use the next program:
for (i in 1:100000) {
? ? ? ? ? ? ? ? ? ? ? ? ? largo <- nchar(names[i]-1)
? ? ? ? ? ? ? ? ? ? ? ? ? names[i] <- substring (names[i],1,largo]
? ? ? ? ? ? ? ? ? ? ? ? ?}
Is another and faster way of do it?
Thanks,
2013 Aug 06
2
data.frame
Hola a todos,
estoy trabajando con dos archivos csv.
En uno de ellos extraigo dos variables (que son coordenadas), del segundo
archivo extraigo otra variable que transformo. Con estas tres variables
construyo un data.frame (las tres variables tienen la misma longitud).
Hasta ahí todo bien, solo que cuando quiero usar este data.frame para hacer
un plot.geodata me marca el siguiente error
Error en
2002 Apr 09
2
couldn't load ext3
Hi
I am running a PC under Linux SuSE 7.2 with kernel 2.4.18, self compiled.
I changed some days ago the partition of my second HD from ext2 to ext3 with the help of tune2fs -j /dev/hdb2 and everything was running OK.
Today, I had a problem with a frozen display and I had to reboot the box cold. During the corresponding forced check I got the following messages:
Quote
---------
/dev/hdb2: reading
2004 Sep 21
1
Bridge master and wine 20040919
Hello
Thanks to Beatriz Botero I know such thing should work nice.
But I try some combinations and always get result as on pictures:
http://www.janek.gwozdzie.dhs.org/pliki/screenbad.png
while it shoud be
http://www.janek.gwozdzie.dhs.org/pliki/screengood.png
I would prefer fake-windows but tried also with real ones.
My system is slackware-current with kernel 2.6.9-rc1 but then I tried
knoppix 3.6
2002 Apr 01
1
Basic questions
Hallo all,
we are completly new to this list and also to wine, so sorry if the question is too simple.
We are trying to install and work with wine, withouth results:
err:win32:PELoadLibraryEXA can't load C:\WINNT\system32/comdlg32.dll
although the file comdlg32.dll exists in the directory.
This is one of three messages I cannot copy from the terminal
Question: our Windows partition is
2013 Oct 29
2
Hoy reunión del "Grupo de Usuarios de R de Madrid - martes 29-octubre"....
Hola a todos:
efectivamente, esas son las librerias que convine tener instaladas.
Llevaré los datos que utilizaremos en un pendrive (por si acaso falla la
wifi) y también el *.md del código para poder seguir la demo sin escribir
todo el código! Para esto, yo creo que lo mejor es abrir el *.md con R
Studio.
Esta tarde nos vemos!
--
Beatriz Martínez
@_bmartinez_
2012 Dec 18
3
Regression line does not show on scatterplot
Hello,
I have done a scatterplot and now would like to add its regression line but it does not show.
Below, the code I have used.
lm3 <- lm(data$S_pH_KCl2.5_BCx~data$B_OleicoPF_BCx_per)
plot(data$S_pH_KCl2.5_BCx, data$B_OleicoPF_BCx_per)
abline(lm3)
I have been able to do the complete operation using the software STATISTICA but it would be great to do it with R.
If you require more details
2012 Nov 05
2
barchart con abline en lattice
Hola a todos:
soy nueva en R así que es posible que la pregunta sea simple, pero no
encuentro la solución.
El caso, quiero hacer un gráfico de barras sencillito, pero con una linea
horizontal que represente la media.
Pues bien, si hago el gráfico sin aplicar la linea, no hay problema:
-----
barchart(web[,2] ~ web[,1],
col="#2C575D",
ylab=colnames(web)[2],
2014 Oct 08
4
Pregunta sobre manipulación de shapefile
Gracias Beatriz, efectivamente, lo que indicas en tu ejemplo es lo que obtengo al final de mi proceso.
En todo caso pruebo tu opción con mis datos, si es como imagino seguro que es más rápida de montar y más elegante que tratar el resultado de un sink() (recuerdo que en su momento lo intenté con fotify pero no supe bien como atacarlo, no conocía el enlace que me mandas, por tanto lo pruebo de