Displaying 20 results from an estimated 200 matches similar to: "Sound shuts off when going past the main menu in MGS1"
2007 Jun 21
1
Using the object of character data type as the name of the slot
Dear all,
I have a character string object:
> chara
[1] "The name of first slot"
and a list object:
> class( try1)
[1] "list"
what I want to do is to use the chara as a slot's name of "try1".
Of course I could do it like:
> try1$"The name of first slot" <- matrix("", 3, 4)
to create a slot of 3x4 matrix with the name
2023 Jul 04
1
Found multiple results for "tga":
I only have a tga user. But it says it has multiple entries.
( ERROR: Failed to add members ['tga'] to group "backup" - Found
multiple results for "tga": )
root at dc0:~# samba-tool group list |grep backup
lpcfg_do_global_parameter: WARNING: The "domain logons" option is
deprecated
ldb_wrap open of secrets.ldb
backup
root at dc0:~# samba-tool user
2003 Nov 07
2
opposite function of strsplit() ?
Hi,
I what to solve this problem:
>alfab <- "ABCEDFG" #[1] "ABCEDFG"
>chara <- strsplit(alfab, "") #[1] "A" "B" "C" "E" "D"
>"F" "G"
Then I do some changes before I want the character together again, say,
remove two letters.
Now,
2023 Jul 04
1
Found multiple results for "tga":
On 04/07/2023 17:14, Edson Wolf via samba wrote:
> I only have a tga user. But it says it has multiple entries.
>
> ( ERROR: Failed to add members ['tga'] to group "backup" - Found
> multiple results for "tga": )
>
> root at dc0:~# samba-tool group list |grep backup
> lpcfg_do_global_parameter: WARNING: The "domain logons" option is
2008 Sep 03
0
[ANNOUNCE] xf86-video-tga 1.2.0
Adam Jackson (3):
Uninclude xf86Version.h
Fix distcheck
tga 1.2.0
Brice Goglin (1):
TGA_*_VERSION using PACKAGE_VERSION_*
Dave Airlie (2):
pciaccess conversion
tga: fixup devPrivates
James Cloos (2):
Rename .cvsignore to .gitignore
Add *~ to .gitignore to skip patch/emacs droppings
git tag: xf86-video-tga-1.2.0
2010 Jun 12
1
Problem launching Cursed mountain
Hello
I installed the game "Cursed Mountain", with no problems, at the end of the installation it asked for launching the game, and the game ran successfully. Later I wanted to launch it again, but now it gets stuck after the logo intro.
The terminal output is:
Code:
---------------------------------------------------
KTM
---------------------------------------------------
Version:
2010 Oct 29
0
Wine release 1.3.6
The Wine development release 1.3.6 is now available.
What's new in this release (see below for details):
- Support for GStreamer filters.
- Mapping of standard cursors to native desktop cursors.
- Improved support for installers with services.
- Many MSXML improvements.
- Decoder for TGA-format images.
- Translation updates.
- Various bug fixes.
The source is available from the
2001 Jan 10
3
Video compression, edge detection, and gcc warnings
<WARNING: Long message ahead>
Well, I have actually done something the past 1 1/2 week. I've created a
program that runs several filters over an image to extract edge
information. Currently it loads any uncompressed grayscale TGA file, and
spits out another uncompressed greyscale TGA file that is 255 at places
where there are edges, and 0 where there are not. I managed to get out
quite
2003 Dec 01
0
No subject
8.
You have join to this mail a text file with the few characters that don't =
match.
On Swat, it's easier. =
I use Swat from my win98 box. When I write a share comment with some chara=
cters, there are not translated properly inside smb.conf file. =
When I read my smb.conf file, I noticed that for example a cp1252 characte=
r like (0xC1) has been changed onto an ISO8859-15 character
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
1999 Jun 17
0
Forw: [RHSA-1999:013-01] New XFree86 packages for Red Hat Linux 6.0
------- Forwarded Message
Return-Path: redhat-watch-list-request@redhat.com
Received: from lists.redhat.com (lists.redhat.com [199.183.24.247])
by sapphire.fnal.gov (8.8.7/8.8.7) with SMTP id VAA26469
for <yocum@sapphire.fnal.gov>; Wed, 16 Jun 1999 21:19:18 -0500
Received: (qmail 7754 invoked by uid 501); 17 Jun 1999 03:06:01 -0000
Resent-Date: 17 Jun 1999 03:06:01 -0000
Resent-Cc:
2003 Dec 01
0
No subject
Specifying Browser Computers
When you start a computer running Windows 2000, the browser service looks in
the registry for the entry MaintainServerList to determine whether a
computer will become a browser. MaintainServerList is found in the following
registry subkey:
\HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\Services\Browser\Parameters
Table I.1 shows the values to which MaintainServerList
1999 Jun 17
0
Forw: [RHSA-1999:013-02] New XFree86 packages (updated)
below.
Dan
___________________________________________________________________________
Dan Yocum | Phone: (630) 840-8525
Linux/Unix System Administrator | Fax: (630) 840-6345
Computing Division OSS/FSS | email: yocum@fnal.gov .~. L
Fermi National Accelerator Lab | WWW: www-oss.fnal.gov/~yocum/ /V\ I
P.O. Box 500 |
2015 Sep 04
0
Login "error" message
Dear Community
I have been receiving the below each time when I log into one of my servers using ssh.
declare -x G_BROKEN_FILENAMES="1"
declare -x HISTCONTROL="ignoredups"
declare -x HISTSIZE="1000"
declare -x HOME="/home/xxxx"
declare -x HOSTNAME="CentOS-66-64-minimal"
declare -x LANG="en_US.UTF-8"
declare -x
2006 Feb 15
0
setup program doesn't find extracted dll
Hello to all,
i'm trying to install the german tax software "Tax@2006".
using: wine 0.9.5 on ubuntu 5.10
I type "wine z:/setup.exe" (z = wine's dos-device cdrom).
the follonwing steps follows:
- Splash Screen "Buhl Data"
- Installshield preparing installation...
- Installshield starts, but brings a Popup:
- Message: "Failed to extract
2011 Jul 19
1
Re: Problem with Windows app accessing internet
OK, here's the diff file:
Code:
--- environment.before.reboot.txt 2011-07-19 17:43:58.200205228 +0100
+++ environment.after.reboot.txt 2011-07-19 17:53:07.549616184 +0100
@@ -1,16 +1,16 @@
ORBIT_SOCKETDIR=/tmp/orbit-charlie
-SSH_AGENT_PID=2912
+SSH_AGENT_PID=2337
TERM=xterm
SHELL=/bin/bash
-XDG_SESSION_COOKIE=2dd5655fe15f1c42f474dd204c45c6b6-1311075950.779608-828425652
2012 Oct 29
3
[Bug 56546] New: crash at the second render when applying gamma correction
https://bugs.freedesktop.org/show_bug.cgi?id=56546
Priority: medium
Bug ID: 56546
Assignee: nouveau at lists.freedesktop.org
Summary: crash at the second render when applying gamma
correction
Severity: critical
Classification: Unclassified
OS: Linux (All)
Reporter: yves at 3delight.com
2008 Mar 02
1
Wrong uptodate
Dear list,
I am syncing files with rsync .... surprise surprise ...
Rsync claims files to be uptudate, but they are not ...
>From the log:
export/opt/bup/status/1 is uptodate
export/opt/bup/status/2 is uptodate
.
.
Source directory (locally on server):
-rw-r--r-- 1 root root 28 2008-03-01 22:44 1
-rw-r--r-- 1 root root 28 2008-03-01 22:37 2
.
.
Destination directory (nfs share):
2005 Nov 30
3
wcmd crashes all the time on the set command.
Below is a crash I get on my gentoo box when I execute
the set command in wcmd. I believe the problem is
caused by wine using the entire enviornment from my
linux machine:
john@jmd0 ~ $ wcmd
WCMD Version 0.17
W:\home\john>set
ALLUSERPROFILE=c:\windows\Profiles\Administrator
ALLUSERSPROFILE=c:\windows\Profiles\Administrator
ANT_HOME=/usr/share/ant-core
CLASSPATH=.
COLORTERM=
2002 Dec 19
0
Failed to delete entry for share
Hi All,
I'm having some minor trouble with an obscure samba feature. I'm using
the remote administration "Server Manager" features of smb.conf.
Specifically the "add share command" "change share command" and "delete
share command". I've written a small C program to do the text-processing
portion of smb.conf file needed for each operation. The C