similar to: Gollden Tee Golf

Displaying 20 results from an estimated 1000 matches similar to: "Gollden Tee Golf"

2006 Apr 17
0
Problem getting R's decision tree for Quinlan's golf exam ple data [Broadcast]
See ?rpart.control. I get: > golf.rp = rpart(Outlook ~ ., golf, control=rpart.control(minsplit=1)) > golf.rp n= 14 node), split, n, loss, yval, (yprob) * denotes terminal node 1) root 14 9 rain (0.2857143 0.3571429 0.3571429) 2) Temperature< 71.5 6 2 rain (0.1666667 0.6666667 0.1666667) 4) Temperature< 64.5 1 0 overcast (1.0000000 0.0000000 0.0000000) * 5)
2006 Apr 16
0
Problem getting R's decision tree for Quinlan's golf example data
Newbie question, but I've checked archives etc. Am trying to reproduce in R Quinlan's trivial example of the "golf" decision tree. The data file of 14 examples follows (read in via read.table()): Outlook Temperature Humidity Windy PlayDontPlay 1 sunny 85 85 false DontPlay 2 sunny 80 90 true DontPlay 3 overcast 83 78 false Play 4 rain 70 96 false Play 5 rain 68 80 false Play 6
2003 Dec 09
0
JP's new online golf store
JP's Golf is a independent golf retail outlet servicing the United States. We opened our doors in 1981 in Parsons Kansas. With this sort of experience, you can be sure that looking after our customers is our primary concern. As specialist golf retailers we offer customers the chance to buy the widest selection of golf equipment under one roof. www.jpgolf.com With a choice of golf's top
2005 Jul 19
0
Your Golf Buddy
2009 Apr 20
0
R Golf?
Hello, This is probably off-topic but have the R community ever organized R Golf contents similar to Perl Golf: http://perlgolf.sourceforge.net/ ? It would be nice to see how R gurus solve problems in many different ways (although you see it at this list every day :-)). Regards, -L
2011 Oct 11
1
c6 xen guest install, golf, and geany
List, Is it possible to do a text install (<512RAM) of C6 server, with support for X11 forwarding over ssh, and get geany (editor) to work over ssh? I got X11 forwarding to work when I have a full Xfce desktop, but not with a server setup. I would like to golf this... IOW find the minimum number of packages. Any hints or kickstart configs for the needy? -- Mark
2004 Aug 19
0
JP's Golf Online
Year end blowout sales on all products. www.jpgolf.com All major manufacturers of clubs, balls, and bags. www.jpgolf.com _______________________________________________________________________ Powered by List Builder To unsubscribe follow the link: http://lb.bcentral.com/ex/sp?c=18568&s=44F0949D7D16C947&m=10
2012 Jun 25
2
setdiff datframes
hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all
2006 Dec 14
0
FW: Server Requirements
davidhooper@tiscali.co.uk wrote: > Hi J, > > >> Hi David, >> Do you know of a flash player that works for icecast and IE7? >> > > Whilst I've never used the software myself I came across Wimpy via the Icecast > forum: > http://forum.icecast.org/viewtopic.php?p=2822& > > You may want to give it a try. > > I'm currently
2012 May 13
1
Help writing function in R....
I need help writing function that takes three categorical inputs and returns a vector of summary statistics based on these inputs. The data set contains information on retail goods that can be specified by their retail segment, brand name, and type of good along with its retail price and what it actually sold for. I need to write a function that will take these inputs and average, count, and
2006 Mar 16
0
World 2006 - Register for the SECNAP and MIS Training Institute Discount!
InfoSec World(tm) Conference and Expo 2006 April 3-5, 2006 Vendor Expo: April 3 & 4 Optional Workshops: April 1, 2, 5, 6, & 7 Disney's Coronado Springs Resort / Orlando, FL http://www.misti.com/InfoSecWorld SPECIAL OFFER! SECNAP Network Security Corp. and MIS Training Institute would like to offer you 10% OFF of the regular undiscounted conference fee of $1495 to attend
2007 Nov 23
1
Disconnected: Mailbox is in inconsistent state, please relogin
Bom dia, Pessoal eu tenho um servidor HP Proliant ML 110 com 4gb de memoria e processador Xeon. Minha distribui??o ? um Fedora Core 7 com Postfix + Procmail e este chama Spanassasim e Clamav Para IMAP, POP3 utilizo dovecot. Estava tendo o erro de Corrupted dovecot.index, atualizei da versao 1.05 para a 1.07 Agora o mesmo problema ocorre algumas messagens ficam presas na caixa e o usuario nao
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2009 Jun 09
3
Wine won't work anymore
Hi All, I'm trying Ubuntu 9.04 these days and Wine to help me with some Win applications. 2-3 days ago I installed Ares and Wine worked perfectly. Since then I can't make it work anymore. When I download an .exe application Wine just 'shakes' my screen but does nothing more. I've even tried the 'Open with Wine' option and I get the same result. Any clue on what can be
2011 Jan 12
1
Problems with compiz, fglrx, and City of Heroes
I just upgraded my video card from an 8800GT to a Radeon HD 5770. I've got the proprietary 'fglrx' driver installed. I am using Compiz/Emerald as my window manager and compositor, with the desktop cube enabled. When I launch City of Heroes full-screen and then try to rotate the cube via hotkey the cube rotates to a new face and immediately repaints City of Heroes over the top of it.
2011 Mar 01
1
Photoshop CS5 Ubuntu 10.10 and 10.04
Hello friends. I have got a problem with Photoshop in wine and compiz. Brush http://fotki.yandex.ru/users/tefery/view/300725/?page=0 Healing brush http://fotki.yandex.ru/users/tefery/view/300903/?page=0 Size over 70px. When i turn off the compiz, it's ok. But in this case when windows is moving it's look like win in soliter. I have updated compiz and wine but nothing happend.
2008 Nov 18
7
Errors using WINE with certain programs
So far I have tried using 4 programs with WINE so far and I have not been able to get any of them to work right. An Emulator program kept blinking, a small desktop application called "catwalk" also was blinking. It took me a while to get those programs closed because of the blinking. I also tried installing the Windows Version of TrueCrypt. It had an error on install. Files were
2007 Mar 01
0
Wide open (security = share) w/ printers including driver download success story
Hi- I wanted to share my experience w/ the list in getting a completely wide open file and printer (w/ automagic driver download) with security = share setup working. My requirement was to setup a server for a small office of XP boxes w/ file and printer sharing and had always done samba as domain controller w/ full logons etc. No need for any security in this setup and I wanted to have the
2007 Jun 10
0
In this case just use 'colorbar' to get a 'legend'.
CAON Releases Fact Sheet For Investors Chan-On International Inc. Symbol: CAON Close: $0.72 UP 4.35% Read this over the weekend, you won't be sorry. CAON has changed direction and investors love it. Friday's volume went through the roof. Big news expected Monday. Set your marker for CAON first thing Monday! Number of generators needed? On two computers the program was slowed down and
2006 Dec 13
2
FW: Server Requirements
Hi J, >Hi David, >Do you know of a flash player that works for icecast and IE7? Whilst I've never used the software myself I came across Wimpy via the Icecast forum: http://forum.icecast.org/viewtopic.php?p=2822& You may want to give it a try. >j Regards, David >-----Original Message----- >From: icecast-bounces@xiph.org [mailto:icecast-bounces@xiph.org] On Behalf