Displaying 20 results from an estimated 1000 matches similar to: "Can't boot Centos6 ext4 partition from GAG bootloader"
2007 Feb 20
0
Uninstalling GAG Boot Manager
Dear friends:
New to Centos, DVD version 4.4. Fabulous distro, rich in features,
applications, very stable and robust.
My first install failed to boot up (after rebooting, switching in Bios from
CD/DVD to hard drive. This was probably because I chose to install the Grub
boot loader in MBR. I got the error message:
GRUB, Stage 2
Loading...
But it never loaded up. Nothing happened.
So, I
2007 Feb 20
0
Uninstalling GAG Boot Manager -- Problem Solved!
Dear friends:
Problem Solved!
I had to donwload a new copy of GAG, install a new copy on a floppy, then
reboot, switch to diskette in the Bios and only then does the GAG
install/uninstall menu show up. Clicked on Uninstall and GAG not only
uninstalled itself from the hard drive but also restored the old MBR. Now
Centos boots up correctly. Thank God.
Benjamin
2009 Aug 20
1
central PDC + remote BDCs: LDAP strategy, my lack of comprehension
Hello, I am trying to figure out how to implement a samba domain in a
number of remote offices around the world with partly bad and often
interrupted WAN connections/VPNs. The goal is to administer the directory
from the central data center.
My obvious choice would be to set up a central server with
SAMBA+OpenLDAP+smbldap-tools and in each remote office a SAMBA server with
OpenLDAP as a
2017 Apr 16
0
Help w/Error #14 in grub legacy in CentOS 6.8
Hi all,
I am getting Error #14 from grub version 0.97 when trying to boot for the first time into a newly installed partition with Scientific Linux 6.7 and need help resolving the error.
The setup:
MacPro with 2 HDs
HD #1: ESP partition has rEFInd installed and running
2nd partition: Mac OSX 10.7.5 (lion) installed
HD #2: 1st partition: Centos 6.8 (uses grub version
2009 Jul 30
2
Any more details on Lance? (just curious; no pressure)
A friend of mine sent me this link:
http://linux.slashdot.org/story/09/07/30/130249/CentOS-Project-Administrator-Goes-AWOL
I went to the main page and read the letter and the "Facts." Are
there any more details, mainly along the lines of CentOS sticking
around - I know you folks all work really hard on this, and you know
better than me how many others depend on you - but - there's
2015 May 26
5
New controller card issues
Running CentOS 5 (long story, will be updated some day). A 5 yr old Dell
PE R415. Whoever spec'd the order, they got the cheapest, embedded
controller. Push came to shove - these things gag on a drive > 2TB. So, we
bought some PERC H200's for it, and its two mates. This morning, I brought
the system down, and put in the card, and moved the SATA cables.
This did not end well.
The new
2013 Mar 21
1
dhcpd options
A few weeks ago, suddenly, reading news at lunch, I could not get to
nytimes.com. I could ping it, and nslookup it, and if I put the IP address
in place of the name, it was fine.
After *much* back and forth over a ticket I put in, over the last week or
so, our group figured it out: It *seemed* to be related to IPv6, and
there's only *some* few sites, such as the Times, and Orbits, and one or
2008 Sep 23
1
Debugging password schemes
Hi, all.
I managed to get my new password scheme routine written, but a couple of
things:
1. The example module lacks an init routine. Since I used it as a
model, my module also lacks one. As such, my newly-built module is seen
but not registered. In the meantime, I moved the routines into
password-scheme.c instead where I had access to all the MD5 routines
already set up for me.
2.
2018 Jun 08
2
C7, encryption, and clevis
Valeri Galtsev wrote:
>
>
> On 06/08/18 10:27, m.roth at 5-cent.us wrote:
>> John Hodrien wrote:
>>> On Fri, 8 Jun 2018, m.roth at 5-cent.us wrote:
>>>
>>>> We've been required to encrypt h/ds, and so have been rolling that out
>>>> over the last year or so. Thing is, you need to put in a password, of
>>>> course, to boot the
2018 Jun 08
0
C7, encryption, and clevis
On 06/08/18 12:01, m.roth at 5-cent.us wrote:
> Valeri Galtsev wrote:
>>
>>
>> On 06/08/18 10:27, m.roth at 5-cent.us wrote:
>>> John Hodrien wrote:
>>>> On Fri, 8 Jun 2018, m.roth at 5-cent.us wrote:
>>>>
>>>>> We've been required to encrypt h/ds, and so have been rolling that out
>>>>> over the last year or
2004 Sep 23
5
Billing Fun - anybody know where to get a NPA/NXX db?
Hello;
I've been playing with a nifty Open Source java based report writer
called Datavision (datavision.sourceforge.net) and I've managed to write
enough logic to calculate phone bills at different rates from the MySQL
cdr's. (cdr_addon_mysql) Eventually I want to have sets of rate
structures for each user of the system - so I can bill client A at 3
cents a minute and client B at 2
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2002 May 25
2
Function objects as arguments of a function
Hello, R users.
In C (or C++) language, a function can be used as
an argument of another function as follows:
// function used as an argument
void foo(int x)
{
...
}
// function using a function as an argument
void bar(void (*func)(int ), int arg1, int arg2)
{
....
}
// The function 'bar' will be called as follows
int main()
{
....
bar(foo, arg4foo, other_arg);
2015 May 28
3
New controller card issues
On Thu, May 28, 2015 10:46 am, Kirk Bocek wrote:
>
>
> On 5/26/2015 11:07 AM, m.roth at 5-cent.us wrote:
>> Push came to shove - these things gag on a drive > 2TB.
>
> I ran into this a couple of years ago with some older 3Ware cards. A
> firmware update fixed it.
>
With 3ware cards depending on card model:
1. the card supports drives > 2TB
2. the card as
2014 Jan 20
3
[PATCH] Add some man pages.
Add very basic pages for:
isohybrid - It's not particularly more useful than --help, but my QA
department really wants this to exist.
memdiskfind - Explain what it does and its invocation.
Signed-off-by: Peter Jones <pjones at redhat.com>
---
man/isohybrid.1 | 61 +++++++++++++++++++++++++++++++++++++++++++++++++++++++
man/memdiskfind.1 | 10 +++++++++
2 files changed, 71
2001 Feb 27
1
RCMD Beginner
Hi, R-users.
I tried to install the 'RODBC' package by input
C:\R>RCMD install RODBC_0_8-2_tar.tar
, but I got the message
'Error: cannot change to directory 'RODBC_0_8-2_tar.tar' '
and failed to install.
The file 'tar32.dll' lies in the system directory.
How can I install the package above mentioned?
OS:Win95
R_HOME:c:\R\rw1020
>From Kobe,
2016 May 18
4
enlarging partition and its filesystem
Hi all!
I've got a VM at work running C6 on HyperV (no, its not my fault,
that's what the company uses. I'd rather gag myself than own one
of th ose things.)
I ran out of disk space in the VM, so the admin enlarged the virtual disk.
but now I realize I don't know how to enlarge the partition and its
filesystem.
I'll be googling, but in case I miss it, it'd be great if
2007 Feb 04
2
APM and suspend to swap
I have been delving into how to get this HP NC4010 to suspend. I think
the practice of just closing the unit for 15+ min inside my backpack as
I move to the next meeting is what cooked my drive...
So it seems that Debian users have been successful with APM:
http://www.proulx.com/~bob/nc4000/ and http://www.gag.com/~bdale/nc4000/
So my Centos related questions are:
I need to turn acpi=off
2019 Jan 21
0
[klibc:master] fcntl: Fix struct flock for 32-bit architectures
Commit-ID: 11bd4ea5f3d960c4d208180deae91d88aa940149
Gitweb: http://git.kernel.org/?p=libs/klibc/klibc.git;a=commit;h=11bd4ea5f3d960c4d208180deae91d88aa940149
Author: Ben Hutchings <ben at decadent.org.uk>
AuthorDate: Mon, 21 Jan 2019 03:39:34 +0000
Committer: Ben Hutchings <ben at decadent.org.uk>
CommitDate: Mon, 21 Jan 2019 03:45:04 +0000
[klibc] fcntl: Fix struct flock
2015 Sep 26
0
Re: Build of supermin 5 on Ubuntu 14.04 LTS
On Fri, Sep 25, 2015 at 04:36:33PM -0500, johnny@johnnypumphandle.com wrote:
> The latest Ubuntu distribution of libguestfs for Ubuntu 14.04
> includes supermin 4.
> guestfish seems to gag.
> Apparently, I need supermin 5 to make things work.
>
> So I downloaded supermin_5.1.9.orig.tar.gz. I unzipped to a source folder /usr/local/src
> Then I