similar to: (semi-) rugged laptop running CentOS 5?

Displaying 20 results from an estimated 400 matches similar to: "(semi-) rugged laptop running CentOS 5?"

2008 Mar 01
1
How to chain user mouse handlers in rgl
Dear Rglers, With rgl, I would like to set marker when a button is pressed, but leave the standard trackball handling otherwise. Thanks to Duncan and Oleg for helping me handling key down. How do I say in a custom mouse handler "after having done your work, forward to standard trackball once only"? The example below shows the idea, but it works only once, then reverts to standard
2005 Oct 25
8
Can anyone please tell me how to strip the white spaces from a character vector?
for example: > a$tic[1:10] [1] "AIR " "ABCB " "ABXA " "ACMR " "ADCT " "ADEX " [7] "ABM " "AFCE " "AG " "ATG " Can anyone please tell me how to strip the white spaces from a$tic? Thanks, Roger [[alternative HTML version deleted]]
2008 Feb 01
2
wxruby2 problems
Hello, I''ve recently installed wxruby2 (version 1.9.4) from a precompiled mswin32 gem. It seems to work fine, and the samples in the distribution all work, but I have a couple of peculiar problems: 1) When I package a trivial wxruby script with rubyscript2exe, the executable is huge - 8.5 MB. With previous versions of wxruby (prior to wxruby2, I think) it was much smaller. Less than 3
2006 Aug 22
1
rsync performance
We're using rsync 2.6.3 to sync two DELL PowerEdge servers with both Redhat-EL4 and otherwise nearly identical hardware (2.8/3GHz, 1GB RAM each). The source machine has a SCSI-RAID1, the destination a SATA-RAID1 disk attached. There are 5 filesystems which are rsynced via ssh. On the smaller filesystems with ~200.000 files/7GB, rsync takes 1-3 minutes: lion:/atg/ ========= Tue Aug 22
2005 Jul 16
2
Logitech Marble Mouse on CentOS 4
Hello there! I just bought this trackball and connected it to a CentOS 4 box. I googled on how to edit xorg.conf for the 2 scrollbuttons, and they work while using this section: Section "InputDevice" Identifier "Mouse0" Driver "mouse" Option "Protocol" "ExplorerPS/2" Option
2007 Feb 06
2
windows xp install + fedora core 6
I am trying to install windows xp in xen. The specs: Intel 2 duo E6400, motherboard Asus P5B. I can create a windows xp guest with virt-manager. The guest boots and the install starts. However after the first reboot, i see the bios screen shortly and after that a black screen. I have looked in tons of docs for the problem, but i never see a fix. How has the answer to my problem?
2008 Apr 20
2
Anyone have experience getting Poser 7 to work?
Hi, I just installed the latest wine and got all kinds of software to work on my box, which is really cool! I'm having trouble with Poser 7, though. I've successfully installed it, and can mostly run it, but it seems like a lot of the windows within tend to disappear mysteriously when clicking outside of them. They come back if you click the right widget, but I find it highly intrusive,
2013 May 11
1
(no subject)
Hello, I am attempting to use the "classInt" package in conjunction with "rworldmap" package in R to construct a chloropleth. I want to use the fixedBreaks argument to specify given breaks. My data look like this: > head(Maji) Country waterused CC 1 Afghanistan 36 AFG 2 Albania 4 ALB 3 Algeria
2012 Jul 05
1
Ruby DSL parameterized classes and defaults
I''ve been reading the Docs on this, and its not very clear. I want to have a parameterized class that takes arrays and objects as parameters. I''m using puppet 2.6.16. I define a hostclass like this: hostclass :test, :arguments => { :param1 => "blah" } do end I call from Puppet DSL: class {"test": } I get this as an error: err: Could not
2012 Jun 25
2
setdiff datframes
hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all
2007 Apr 25
1
Centos 5 Reproducible Reboot
Guys, I've just setup 5.0 and can reproduce a crash/reboot every time. Details; x86_64 Install Using Xen Kernel System fully updated including Xen Kernel (latest 1.1 update) Intel Dual Core E6400 4gb RAM I've installed vmware server 1.0.2 from rpm. It has been configured and is ready to create new machines. I have successfully created a new machine but when I attempt to power-on the
2010 Aug 07
1
PXELINUX LocalBoot 0 fail; hunting for bug
Recently, I decided to pull out a new model laptop for testing related to my job at work. Dell Latitiude E6400, BIOS A14. Normally I have it set to boot CD, USB, Net, then HDD and noticed that with PXELINUX-4.02 and 'LOCALBOOT 0', it hung on me before leaving the PXE stack. I then tried 3.86 and it worked. 4.00 and 4.01 both hung when I tested them as well. Changing to 'LOCALBOOT
2009 Dec 26
2
A program under WINE claims I don't have enough memory
I'm running Origin 7 Server (a scientific data & graph editing software) under Ubuntu 9.10. Installation was fine and I can read files and edit them, but as I try to save the simplest thing (which takes less than a MB) the program claims I have no disk space (I do have more than 10GB free). I have a 64GB solid-state hard drive on my Dell E6400 laptop. This problem persists no matter where
2011 Jan 27
1
[PATCH][git-pull] memdisk/dskprobe.c
git://git.zytor.com/users/genec/syslinux.git Branch memdiskdbg-for-sha0 This starts with adding another check in two of the disk probes (by Shao; Thank you), expands the debug output, adds an additional check in the third probe and expands/reorders the debug output. At this time, it appears to resolve the MEMDISK issues that Jason Vasquez first noticed. The additional check in the third probe
2020 Oct 22
0
3d plot of earth with cut
If you have "value" as a function of latitude and radius, isn't that a 2D (not 3D) scalar field? Which can be plotted using a regular heatmap. If you want a curved edge where depth=0 (radius=?), that's not too difficult to achieve. Not quite sure what continent boundaries mean in this context, but that could possibly be added to. Or do you want a 2D slice superimposed within a
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2011 Apr 19
2
Centos 5.3, Firefox, and JRE
I can't get java applets to run in Firefox. We are using centos 5.3, firefox 3.0.11. Java version 1.6.0_24 is installed. java version "1.6.0_24" Java(TM) SE Runtime Environment (build 1.6.0_24-b07) Java HotSpot(TM) 64-Bit Server VM (build 19.1-b02, mixed mode) I know there has been allot written about this issue. I did look and there is no jre plug in installed for Firefox. I
2007 Jul 19
5
ridiculous slow gigabit transfer, faster with VNC
Hi, I have a problem with file transfers between a windows systems and unix systems. I have one win32 desktop (intel e6400 2Gb Ram), one win32 laptop (p-m 2Ghz). Also one linux laptop (p-m 1.4GHz) and one opensolaris desktop (intel e4400 1GB Ram). The two laptops have built-in 100Mbit ethernet and desktops have 1Gbit ethernet on the motherboard. Both desktops use a Marvell Yukon. The file
2008 Oct 24
7
combining data from different datasets
Hi, I have two tables: > iso continent code code3 codenum country 1 EU AD AND 20 Andorra, Principality of 2 AS AE ARE 784 United Arab Emirates 3 AS AF AFG 4 Afghanistan, Islamic Republic of 4 NA AG ATG 28 Antigua and Barbuda 5 NA AI AIA 660
2011 Jan 08
3
MEMDISK issues and Dell OptiPlex and Latitude systems
Hello all. Again I call upon the greats of this mailing list to help me with an issue related to MEMDISK - notably when paired with various Dell OptiPlex and Latitude systems. The issue presented itself sometime ago and I best dealt with it by remaining with version 3.83 of the SYSLINUX package. But valuing the improved changes fostered by newer versions, I would prefer to move forward with