similar to: Interruptible announcements in queue application

Hello all, we're using asterisk 1.2.12.1 in an Inbound callcenter using the queue application. If there are many calls in the queue, it sometimes takes up to 30 Seconds before a call is distributed to an agent. For example there are 10 callers in the queue, an Agent is finishing a call and it takes up to 30 seconds before his phone rings again. We're already set the

Hey List, Anyone know the correct way to override an announcement on a queue by queue basis? My goal is to have one of my queues say "press one to blah.." and no position announcements I have the jump from queue context working (the press 1) I just need the correct message played to the user instructing to press 1. I have periodic-announce=filename in my queues.conf file under the

Dear all,   i would like to count the number of times where I have combined occurrences of the categories of 2 variables.   For instance, in the dataframe below, i would like to know how many times each author (au1, au2, au3 represent the first, second, third author) is associated with each of the category of the variable 'nam'. The position of the author does not matter.   nam <-

Hello all, I've seen that the application AgentCallbackLogin()has been set to deprecated in version 1.4. So I've done some tests based on the tutorial "queues-with-callback-members.txt" coming with version 1.4. What's not clear for me is what is happening to agents.conf, it seems that it's no longer needed, and I have to define my agents using variables in

Hi Jeremy, An easy way to start troubleshooting these is to look at the audit logs and > see what SELInux is blocking. You have /McFrazier in the email.. if that's > off the root tree than unless you've set permissions to allow httpd to look > at tat folder, I bet that's one problem. > if you run ls -Z you can see the labels that are present on those folders, > that

On Wed, Nov 02, 2016 at 07:15:17PM +0200, Timo Sirainen wrote: > On 01 Nov 2016, at 18:26, The Doctor <doctor at doctor.nl2k.ab.ca> wrote: > > > > Getting complaints from people about pop/imap > > > > issues. > > > > some people are getting repaeted e-mail. > > > > Other are not able to delete their e-mails from an IMAP lcient. >

Hi, After playing around with queues a bunch on 1.4.26.2, I noticed a few things, which the patch below addresses. It addresses: - Callers in position 0 will hear periodic/position announcements at a very different rate than all other callers. -- Announcements while in position 0 could be delayed up to "timeout+retry" seconds. -- This patch reduces that possible delay to only

> resp <- postForm('http://our.db/db/new', 'profileid'='181133', 'value'='20110225', 'type'='history','user-agent' = 'R', .opts =list(verbose=T, userpwd='test:test')) * About to connect() to our.db port 80 (#0) * Trying 192.168.1.1... * connected * Connected to our.db (192.168.1.1) port 80 (#0) > POST

Hello To update from R 2.6 to 2.8 (on Ubuntu 8.04 both) I had to install new tcl and liblapack packages (excuse me it is in french): > sudo apt-get install r-base-dev > Lecture des listes de paquets... Fait > Construction de l'arbre des d?pendances > Lecture des informations d'?tat... Fait > Les paquets suppl?mentaires suivants seront install?s : >

Dear all, I am working on an author network and to do so I have to arrange a data.frame (tutu) crossing author names (rows) per publication number (column). The participation of the author to a study is indicated by a 1 and 0 otherwise. I have a vector (xaulist) of all the names of authors and a data.frame (tata) with all the publications in row and the authors in columns. I have writen a loop

i`ve found a bug in chain.c32 in v4.06. When i use isolinux it does not run windows7 installation, chainloading bootmgr. the error is: Can't find myself on the drive I booted from. chain.c32 from syslinux 3.xx works like a charm! chain.c32 from syslinux 5 shous tat this is not a com32 app

Hello all, I've a question regarding the values "completed" and "abandoned" that are returned by the manager command "queuestatus". What is the timeframe for these values, are they counted since the last asterisk boot, or per day, or is the timeframe configurable? Thanks and Regards Markus

I could actually go for once, but haven't seen any annoucement... Thanks, --paulr

Hello group, I tried a lot to enlarge the frequency (i.e. more announces, low wait between). according to config, every 30 seconds the announcement should take place. In fact, the first periodic announce is done after 2 minutes? What is my fault? Thank you Regards Paul # zypper if asterisk Loading repository data... Reading installed packages... Information for package asterisk:

Hi List, I run XEN 2 since some month (unfortunatly installed by a fiend of mine). Recently I bought some new hardware and tried to get XEN 3 running on a Debian Sarge 3.1. I installed via the Debian installer a RAID 1 with LVM. even though there are some devfs_mk_dir errors systems comes up. Now I installed XEN but system doe not boot as the boot device seems not to be recocnized by the

Hi, using both OpenSSH_2.5.1p1 (compiled myself) and openssh-2.9p1-23.i386.rpm from ftp.suse.com 7.2_update I get the following "leak" : using `scp' I tried to copy a file from a local floppy disk to a remote system, but the disk had an read error and scp didn't get any real data from floppy: turtle koenig > scp /media/floppy/file.c harald:file.c

Hi there, I think I have found a small problem in the "/my/path/R-2.0.1/src/modules/X11/MakeFile" generation. During the configure step, I have specified a specific JPEG library by exporting CPPFLAGS variable. All compilation works well for individual files in the src/modules/X11/ directory, but when linking, the -ljpeg option doesn't work. I obtain the following message (in french

Hi Samba People ! I'm experiencing some issues with the smbldap-tools suite and post it here in hope someone could give me some help. I want first to thank you if you take teh time to read my message til the end, as it's a little bit long ;) We do have a Debian Box on our LAN we use primarily as a File Server. This server has initially been setup with Etch (4.0, net-install). I've

Hi all, I have a problem when I try to compil samba 4.0.6 on my test machine (suse linux enterprise server 11 SP2 32-bits). output of compilation : [3353/3781] Linking default/lib/param/libsamba-hostconfig.so [3354/3781] Linking default/lib/tdb_wrap/libtdb-wrap.so [3355/3781] Linking default/libcli/security/libsamba-security.so [3356/3781] Linking default/lib/util/libutil_tdb.so

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >