similar to: Asterisk processes

Displaying 20 results from an estimated 3000 matches similar to: "Asterisk processes"

2013 Mar 28
1
Samba4: File ownership for Domain Admins members
Hi I've just installed Samba 4.0.4 on FreeBSD to test for the moment. Everything so far has gone very well: joining the domain, GPO's etc. However one thing that is happening which I find unusual, is the owner of files created by a user who is a member of the Domain Admins group as well as Domain Users. All files created by the user are owned by id 3000000 (which I believe S4 maps to
2008 Jan 05
11
Help with booting dom0 on a Dell 2950
Hi, I have installed b_78 on a Dell 2950 and booting to bare metal works fine but when I try to boot using the grub entry Solaris xVM it will boot to the point where it displays the uname info and then just stays there. It will not boot past that point. I have enabled VT technology in the BIOS (but only after the installation). Where/what can I look at to trouble shoot this? I am new to xen and
2008 Jul 08
4
Can R do this ?
I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2009 Mar 24
3
Summarizing each row into a frequency table
I have a matrix containing -1, 0, 1, however certain rows will not have all 3 numbers. I have written some codes to compute the frequency table of how many -1s, 0s, 1s per row, but it is very ugly and not efficient if there are more than 3 numbers. Please suggest. m <- rbind(sample(0:1, replace=T, 10), sample(-1:1, replace=T, 10)) m.table <- t(apply(m, 1, function(x) c(sum(x==-1, na.rm=T),
2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]
2008 Jun 10
2
Fast method to compute average values of duplicated IDs
Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]
2009 Jan 06
2
Generating GUI for r-scripts
Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]
2009 Mar 12
4
Serving 120 concurrent calls
Hello, a local prison contacted us regarding some calling card solution. they need 4 E1s to serve 120 rooms in that prison. we are planning on using 4 servers to serve the calls and one for the database servers' specifications are: 2.8 Dual Core Proccessors 2 GB Ram 160 Sata Drive each server will be provided with 1 E1 card Questions are: 1- will those servers be able to handle that ammount
2006 Jul 10
2
acts_as_ferret 0.2.2
Hi all, I just tagged acts_as_ferret 0.2.2 as the current stable version, so get it while it''s hot ;-) new features: - added support for the multiple models/single index approach. - find out the total number of search results by calling total_hits on the array returned by find_by_contents. fixes: - trac tickets #20 (find_by_contents breaks ferret sorting) and #24
2008 Aug 07
0
Re: away
i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com Thanks. Best Regards, Choon Kiat _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users
2008 Aug 05
0
Re: away
i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com Thanks. Best Regards, Choon Kiat _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users
2009 Jan 13
9
Updating multiple databases at the same time
I have an application that is load balanced. I have a master database which I update once a day. Then I push the raw mysql files to all other servers so they are the same as the master. This works fine, but there are a few situations where I need all databases to update in real-time. What would be the best way to achieve this in rails? Here is an example of what I am trying to do. I want to
2009 Jul 08
9
Question about optimal filesystem with many small files.
Hi, I have a program that writes lots of files to a directory tree (around 15 Million fo files), and a node can have up to 400000 files (and I don't have any way to split this ammount in smaller ones). As the number of files grows, my application gets slower and slower (the app is works something like a cache for another app and I can't redesign the way it distributes files into disk due
2008 Dec 03
2
Speeding up casting a dataframe from long to wide format
Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",
2008 Nov 26
2
Very slow: using double apply and cor.test to compute correlation p.values for 2 matrices
My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value
2007 May 29
2
Noise suppression less than AGC gain
Hi, I've had a small case with noise suppression and AGC. I have a fairly noisy environment here, and with the default parameters, noise suppression works fairly well while I talk. However, when I shut up, AGC starts slowly increasing the gain until it has amplified whatever noise is left to levels about equal to having no filtering at all. As soon as I talk, AGC backs down fairly quick