similar to: IPv6 and sshd

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hello everyone, I am trying to "parse" a part of LLVM IR. More exactly, from @.str = private unnamed_addr constant [3 x i8] c"DS\00", section "llvm.metadata" I want to get "DS". It is the single place in the whole bytecode from where I can get it. I have : ... Value *VV = cast<Value>(LD100->getOperand(1)->getOperand(0));

PowerDNS supports CAA records beginning with version 4.0, but the pdns package in EPEL for most recent centos versions is stuck at around version 3.4 (3.4.11 is what I have). Do I have no other choice but to manually compile and maintain my own pdns installation? I prefer to avoid this but I need up-to-date features. Perhaps there is a PowerDNS specific work-around? Maybe the EPEL

Hello list! When em0 has an inet address while bridge0 doesn't, it seems to be OK: ----- bs1% uname -a FreeBSD bs1.sp34.ru 7.0-STABLE FreeBSD 7.0-STABLE #0: Sun May 25 20:15:26 MSD 2008 root@bs1.sp34.ru:/usr/obj/usr/src/sys/BSM i386 bs1% ifconfig em0; ifconfig tap0; ifconfig bridge0 em0: flags=8943<UP,BROADCAST,RUNNING,PROMISC,SIMPLEX,MULTICAST> metric 0 mtu 1500

Hello I have some problems with 3Com nics, after a upgrade from 5.5-STABLE to 6.4-STABLE. This machine has two 3com nics (one is LAN other is WAN) and i see too much "watchdog timeout" on both cards. This on/off up/down on cards, affect the interrupt to clients that are downloading from apache web server, especially on large files. --------------------------------------------

Hey, It is some real awesome work you are doing. Thanks. I have been trying to use gpxe - pxelinux to boot Linux from a remote location. It works with pxelinux 2.02 and lower. However pxelinux 2.03 and higher return errors and booting is incomplete. Why? syslinux-3.00 gives the following dump and hence the system does not boot. Loading Linux...........................................Ready.

Dear Sirs/Madam, I am a beginner to R, and I am currently working on a data matrix which looks like this: > head(oligo) ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012 AAA 370 631 365 67 164 455 491 KAA 603 1208 170 157 68

I''m trying to manage network files on two nodes, "vico" and "backup." The component "vico_network" below works fine. define vico_network ($owner = ''root'', $group = ''wheel'', $mode = ''644'', $cro_int = ''ne3'', $carp0_skew = '''', $carp1_skew =

Hi, I got the following output booting through PXElinux. I used a netboot floppy image for my ISA NE2000 (RTL8019) network card to download the pxelinux.0 file from my server. I use syslinux 3.07. Here's my output: PXELINUX 3.07 2005-01-12 Copyright (C) 1994-2005 H. Peter Anvin ######################################################## # Welcome to the Petteflet PXE booting infrastructure. #

hello ! i try to use a network technology on one single host, which wasn`t designed for that. to give a short overview of what i`m talking about: AoE is just like a "networked blockdevice" (just like nbd/enbd) - but without tcp/ip. AoE kernel driver is the "client end" (see this like an iSCSI initiator) - and an etherblade storage appliance is the "server end"

Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: > > Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >> So far, I've only been able to filter HTTP. >> >> Do any of you do transparent HTTPS filtering ? Any suggestions, >> advice, caveats, do's and don'ts ? > > After a week of trial and error, transparent HTTPS filtering

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I tried to use calcMin with a function that uses a number of ... arguments (all args from resid on) besides the vector of parameters being fit. Same idea as optim, nlm, nlminb for which this form of ... syntax works. But with calcMin I get an error regarding unused arguments. No partial matches to previous arguments that I can see. Anybody know the reason or fix for this?

How do I allow traceroute to reach my server? Pings work fine but traceroute stops at the last hop before my server. If I shut off the firewall it reaches it fine. PING danicar.net (24.222.246.120): 56 data bytes 64 bytes from 24.222.246.120: icmp_seq=0 ttl=237 time=104.0 ms 64 bytes from 24.222.246.120: icmp_seq=1 ttl=237 time=74.9 ms 64 bytes from 24.222.246.120: icmp_seq=2 ttl=237 time=90.6

Morning All, I have a boolean value called: countyid with the i.d. of XL Is it possible to give a unique entry two values so if I search for XL1 or XL2 this unique entry is shown in both queries? Cheers John

Hi everyone, If you have experience using Samba < 2.0.7 with AutoCAD 2000/2000i or R14 on a LAN, where the Windows 2000 Professional clients running AutoCAD 2000/2000i are opening .dwg files and XREFS off of the server, particularly if you know tips on tuning Samba's performance so that AutoCAD reports it can't find files on the server or load XREFs, please either post your comments to

On 03/05/18 08:34, Bill Gee wrote: > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>> >>>> Do any of you do transparent HTTPS filtering ?

Hey, It is some real awesome work you are doing. Thanks. I have been trying to use gpxe - pxelinux to boot Linux from a remote location. It works with pxelinux 2.02 and lower. However pxelinux 2.03 and higher return errors and booting is incomplete. Why? syslinux-3.00 gives the following dump and hence the system does not boot. Loading Linux...........................................Ready.

> Am 05.03.2018 um 15:34 schrieb Bill Gee <bgee at campercaver.net>: > > > On Monday, March 5, 2018 7:23:53 AM CST Leon Fauster wrote: >> Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: >>> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >>>> So far, I've only been able to filter HTTP. >>>>

Hi, Is this method broken in R? I am using it to find roots of the following function: f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100 It is giving an answer of -38.4762403 which is not even close (f(x) = 2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This function should converge.. Even for a simple function like f(x) = exp(-x) * x, it gives