similar to: Intel 82557-based Integrated Ethernet PCI (10/100)

Hi all I have a Zenith N-Station (1997) P166 64 Mb of Ram it has a Intel LANDesk Service Agent version 0.98i it doesn't seem to be flashable I have tried methode from http://syslinux.zytor.com/pxe.php Each time I use ethereal to check the protocol The behavior is quite strange : I have the "Boot :" line the pxelinux is loading correctly But when I ask my image pxe, I have dumps

Hi, I've been using pxe-enabled nic's with an lzpxe-etherboot image generated by rom-o-matic.net to boot a ltsp.org kernel, with dhcp 3 to use if statements to determine which filename option he gives to the pxe/etherboot dhcp client.Explained at http://www.ltsp.org/documentation/pxe.howto.html This works perfectly, except for the fact that you can't use 1 etherboot pxe image for

Hi I have searched the site, list archives, google etc and have not been able to find an appropriate answer so I am asking it here. Apologies if this has been answered already. I have a kiosk-style pc which I wish to remote boot to keep it quiet. This way I don't need a hard disk at all, keeping it truly silent as it has a passive cpu cooler. Unfortunately, it has no upgrade options. I

Hi! I have been using pxelinux with memdisk to boot our workstations with our custom floppy, which is a MSDOS boot disk (actually it is win98) On one of the PC's I'm testing, a Fujitsu-Siemens which has an AMDtek based on-board network card and when PXE is activated, it gets an IP from the DHCP, then it finds the TFTP server, downloads pxelinux.0, executes it which causes the floppy to

I have just pushed out SYSLINUX 3.10-pre21; this fixes ISOLINUX, and adds a fix for MEMDISK -- it so happens that running ISOLINUX under Bochs triggers a bug with similar behaviour as I've seen reported on here, so I'm *hoping* this might fix the "doesn't work without harddisk" problem and perhaps the IBM/USB problem some people have been reporting. Again, I really want

I'm trying to network-boot a GCT Allwell set-top box without success. My frustration level is high. The problem seems to be that the Allwell is sending a RRQ with an option. tftp-hpa responds with an OACK, and waits for the corresponding ACK from the Allwell. The Allwell never sends that ACK, but instead continues with the same RRQ until timeout. Having read RFC1782, this makes me think

Hi, I'm planning to get my Asterisk box out of the LAN, get rid of my router and make the box acts as a Router, Firewall, DHCP Server (with Shorewall). I'll do that to be able to use some SIP clients remotely. Does anyone doing the same with the Asterisk box, is it a good idea, is there any other solution for the SIP emote Clients. Regards. __________________________________

Hi guys, I have a couple Mitsubishi 2033C UPSes that I badly want data from. We used to have Mitsubishi Netcom devices which took the serial output and provided a web interface, SNMP, and email alerts. All of those devices died. They're really awful devices (they're clunky and have 386s in them) and not worth the pricetag for a replacement. The closest replacement I've seen

Greetings all. Any help with the following would be appreciated. I want to create a data frame for each file in a directory. The following code does not work but it may show what I am trying to do: carmakes <- c('BMW','Chrysler','Citroen','Fiat','Ford','Holden','Honda',

I''ve been hacking at puppet for the past week or two, and came up with some great stuff, but I''m wondering if there''s a way to tie it all together To create a virtual machine for our company''s QA environment, I''m currently doing 3 things: #create a vm node vmsvr2 inherits default { include vmserver vmserver::vm {

Hello, R users. In C (or C++) language, a function can be used as an argument of another function as follows: // function used as an argument void foo(int x) { ... } // function using a function as an argument void bar(void (*func)(int ), int arg1, int arg2) { .... } // The function 'bar' will be called as follows int main() { .... bar(foo, arg4foo, other_arg);

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Ralf Baechle wrote: > I'd like to point those who you need to use these crude workarounds: > > echo 1 > /proc/sys/net/ipv4/ip_no_pmtu_disc > echo 4096 32767 > /proc/sys/net/ipv4/ip_local_port_range > > at a new version of tftp-hpa which solves the PMTU problem by disabling it > only for the tftp client and introduces a new -R begin:end option which > allows

Hi All, I am doing some testing with the asterisk server and have been monitoring the packets exchanged during a SIP-ZAPTEL phone call. I see that the IP-ID in all of the RTP/UDP/IP packets are set to zero. After some googling, I have learnt that some of the linux implementations set the IP-ID to 0 (if the DF bit is set in the IP header) if the two hosts exchanging data are on the same subnet.

Hi all, I'm trying to run Geeks Toy (http://www.geekstoy.com/) but get an error Code: [aeo at localhost AGT Pro]$ ./AGT\ Pro.exe fixme:mscoree:ConfigFileHandler_startElement Unknown element L"configSections" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element L"connectionStrings" in state 1 fixme:mscoree:ConfigFileHandler_startElement Unknown element

I am using 'igraph' package to make some graphs of 'gene-gene interaction'. I can get a data.frame which has three columns. gene1 gene2 pvalue AGT MLR 1.2e-04 MLR 11BHSD1 1.71e-05 IFG2 11BHSD2 2.2e-07 . . . . . . . . . AGTR1 NPPA

My company is now in the process of rolling out enterprise desktop systems (mostly rhel3 since we have some commercial software that is not quite ready for rhel4). Most of our users (ca. 120 workstations) are using RH9. I've developed a simple, extensible set of kickstart post procedures and firstboot procedures that provide a quick way to image new systems, but one thing is missing. I

Hello, I am using tapply to pull out data by the day of week and then perform functions (e.g. mean). I would like to have the number of values used for the calcuation for the functions, sorted by each day of week. A number of entries in any given column are NAs. I have tried the following code and simple variants with no luck. for (i in 1:length(a[1,])){ x<-tapply(a[,i],a[,1],mean,

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I am not too familiar with the specs for the .ogg format but have some ideas.. Maybe the existing format already addresses these but as others here would know better, I write this problem: with hundreds or thousands of songs/speeches it is hard to do a word search for a recalled verse or phrase. I suggest adding a linked or imbedded text field. for speeches, a transcript could be attached to