similar to: recent dovecot: assertion failed.

Hi, I am trying dovecot-1.1 with dovecot-sieve-1.1. First, dovecot -n do not report about deliver settings. They are: --- protocol lda { postmaster_address = postmaster at parkheights.dyndns.org hostname = parkheights.dyndns.org mail_plugins = cmusieve mail_plugin_dir = /usr/lib64/dovecot11/modules/lda sendmail_path = /usr/lib/sendmail auth_socket_path = /var/run/dovecot11/auth-master

I have problem with dovecot-1.0.3 and apacheds ldap server. If I change just uris in dovecot-ldap.conf to point to fedora-ds server, everything works O.K. I've tried with apacheds ldap server versions 1.0.2 and 1.5.0 command line search with parameters taken from dovecot.debug log gives me all needed attributes. Comments and help welcome. Here is my data: --- # /opt/dovecot/sbin/dovecot -n #

Hi, Thank you for pointing me about -xc99 flag, I have compiled and installed dovecot inplace of version 1.0.5 without any special actions on the upgrade. And after starting it immediately got in it's log file messages like: --- dovecot: Oct 16 23:10:18 Error: IMAP(seriv): file_set_size() failed with index cache file /var/spool/imap/seriv/.imap/.git-altlinux-ru/dovecot.index.cache: Invalid

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

Hi, I'm trying to use dovecot-1.0.rc7. Before I've used dovecot-1.0 from nightly cvs build of August 08, 2006. It worked perfectly, on Linux 64-bit, you can see spec and patches at http://www.sisyphus.ru/srpm/dovecot/ When I tried to upgrade to rc7 and to recent nightly cvs builds with the same configuration and patches (provided necessary adaptations), it builds O.K, but can not move

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

I just noticed one instance of this in the current CVS version: dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834 < 2872) dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids): assertion failed: (*seq != 0) dovecot: Jul

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

I'm trying to use dovecot-deliver with sieve plugin, delivering to Maildirs. Everything seems working O.K., but I'm getting the following lines in /var/log/maillog: --- Mar 29 00:06:00 alt64 dovecot: imap-login: Login: user=<seriv>, method=PLAIN, rip=66.80.117.2, lip=192.168.10.8, TLS Mar 29 00:06:00 alt64 dovecot: IMAP(seriv): mmap() failed with index file

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

Hi, I'm trying to use dovecot for storing mailing lists and read-only access for users. The OS is Solaris, authentication for all readers of these lists are from Ldap through PAM, and one local user "listuser" will receive all mail and store them into it's folders (Maildirs). These maildirs are readable (read-only) for all others and they are shared by setting --- mail_location:

Hi Timo, I can't find licensing information in http://hg.dovecot.org/imaptest. Can you tell what is the license for this utility? I'd like to package it for ALTLinux Sisyphus repository. -- Sergey Ivanov

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

Hi, I have a problem, delivery called from /etc/aliases file by pipe delivers with mode 0600. I need system users with shared mail folders (Maildir format). When I changed alias to pipe to shell wrapper with mode 002 set in it, nothing changed. MTA is sendmail, OS Solaris, and dovecot version 1.1.1. Can somebody help? Here are dovecot settings: --- /opt/dovecot11/sbin/dovecot -n # 1.1.1:

Hi, I'm trying to build dovecot from snapshot dovecot-20051215.tar.gz on OpenSolaris Nevada build 28. I have added to the PATH directories for make, gcc and automake/autoconf (in BASH): $ export PATH=/opt/sfw/bin:/usr/ccs/bin:/usr/sfw/bin:$PATH then executed --- $ aclocal $ libtoolize --force $ automake --add-missing $ autoheader $ autoconf --- And then make finished with --- Install prefix