Displaying 20 results from an estimated 2000 matches similar to: "recent dovecot: assertion failed."
2007 Jul 25
3
dovecot-1.1 + dovecot-sieve-1.1 deliver backtraces
Hi,
I am trying dovecot-1.1 with dovecot-sieve-1.1.
First, dovecot -n do not report about deliver settings.
They are:
---
protocol lda {
postmaster_address = postmaster at parkheights.dyndns.org
hostname = parkheights.dyndns.org
mail_plugins = cmusieve
mail_plugin_dir = /usr/lib64/dovecot11/modules/lda
sendmail_path = /usr/lib/sendmail
auth_socket_path = /var/run/dovecot11/auth-master
2007 Aug 03
2
dovecot-1.0.3 & apacheds ldap
I have problem with dovecot-1.0.3 and apacheds ldap server.
If I change just uris in dovecot-ldap.conf to point to fedora-ds server,
everything works O.K.
I've tried with apacheds ldap server versions 1.0.2 and 1.5.0
command line search with parameters taken from dovecot.debug log gives
me all needed attributes.
Comments and help welcome.
Here is my data:
---
# /opt/dovecot/sbin/dovecot -n
#
2007 Oct 18
2
more problems with dovecot-1.1 beta3
Hi,
Thank you for pointing me about -xc99 flag, I have compiled and
installed dovecot inplace of version 1.0.5 without any special actions
on the upgrade. And after starting it immediately got in it's log file
messages like:
---
dovecot: Oct 16 23:10:18 Error: IMAP(seriv): file_set_size() failed with
index cache file
/var/spool/imap/seriv/.imap/.git-altlinux-ru/dovecot.index.cache:
Invalid
2008 Feb 23
2
counting sequence mismatches
Hello
I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this:
seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")
2012 Oct 17
3
subtotals based on price bands?
I would like to create a subtotal table with custom bands.
seq1 = seq(0, 100, by = 5)
seq2 = seq(100, 1000, by = 100)
Bands = c(seq1, seq2)
#Prices
Prices = sample(1:1000, 200, replace=F)
#corresponding size for the given price above.
size = sample(1:1000, 200, replace=F)
How would I find the subtotal of the size based on a given price falls
within a band?
--
View this message in
2007 Dec 05
2
exim/kmail vs. dovecot
I am using exim via dovecot_deliver to store messages in Maildir in my $HOME.
I am using kmail to retrieve stuff. Unfortunately, something in my data
crashes dovecot.
I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from
the site.
Here is the crash:
Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c:
line 629 (mail_index_update_flags_range):
2006 Sep 28
2
which e-mail client can work with recent dovecot?
Hi,
I'm trying to use dovecot-1.0.rc7.
Before I've used dovecot-1.0 from nightly cvs build of August 08, 2006.
It worked perfectly, on Linux 64-bit, you can see spec and patches at
http://www.sisyphus.ru/srpm/dovecot/
When I tried to upgrade to rc7 and to recent nightly cvs builds with the
same configuration and patches (provided necessary adaptations), it
builds O.K, but can not move
2008 Feb 21
1
Selecting timestamps
R-users,
I have two vectors (of timestamps)
d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M"))
d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M"))
seq1 <- seq(d1, d2, "hours")
seq1
d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M"))
d4 <-
2008 May 28
2
Unexpected behaviour in reading genomic coordinate files of R-2.7.0
Great R people,
I have noticed a strange behaviour in read.delim() and friends in the R
2.7.0 version. I will describe you the problem and also the solution I
already found, just to be sure it is an expected behaviour and also to
tell people, who may experience the same difficulty, a way to overcome it.
And also to see if it is a proper behaviour or maybe a correction is needed.
Here is the
2007 Jan 26
2
Why do return or visible don´t return my objekt?
Dear RRRRRrrrrrrrrlist!
I?ve got two lists which contain sets of DNA-sequences. They look
something like this:
List of 33
$ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ...
$ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ...
$ Cunonia_capensis : chr
2007 Sep 02
2
imap process consuming 100% CPU (Dovecot 1.0.3)
Hi,
I have yet another problem with Dovecot: sometimes (rarely, maybe
once every few days) one of the imap processes will 'hang',
consuming all available CPU time. It does not seem to 'finish' in any
reasonable amount of time (in one instance I waited a few days). This
process will not even exit gracefully, it needs to be killed with
'kill -9 <PID>'.
It has
2005 Jul 18
2
Assertion failure in mail-index-transaction.c
I just noticed one instance of this in the current CVS version:
dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): mbox sync: Expunged
message reappeared in mailbox /mailhome/new/o/h/mailuser/mbox (UID 2834
< 2872)
dovecot: Jul 18 15:25:48 Error: 5962 IMAP(mailuser): file
mail-index-transaction.c: line 129 (mail_index_buffer_convert_to_uids):
assertion failed: (*seq != 0)
dovecot: Jul
2019 Jan 15
2
Cannot access other computers on LAN
Hello Julien,
Am Mon, 14 Jan 2019 22:15:47 +0100
schrieb Julien dupont <marcelvierzon at gmail.com>:
> ** Test 1 **
> On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3'
> When pinging 192.168.1.1 from client 1, with no success, I see no packet
> passing.
Sorry - the tcpdump command should end with "192.168.1.1" instead of
2007 Mar 29
2
dovecot mmap() complaints: No such device
I'm trying to use dovecot-deliver with sieve plugin, delivering to
Maildirs. Everything seems working O.K., but I'm getting the following
lines in /var/log/maillog:
---
Mar 29 00:06:00 alt64 dovecot: imap-login: Login: user=<seriv>,
method=PLAIN, rip=66.80.117.2, lip=192.168.10.8, TLS
Mar 29 00:06:00 alt64 dovecot: IMAP(seriv): mmap() failed with index
file
2012 Feb 20
1
counting characters starting point
I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y.
seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO
I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of
2008 Jul 24
3
how to store flags \Seen into read-only mailbox?
Hi,
I'm trying to use dovecot for storing mailing lists and read-only access for users.
The OS is Solaris, authentication for all readers of these lists are from Ldap through PAM, and one local user "listuser" will receive all mail and store them into it's folders (Maildirs). These maildirs are readable (read-only) for all others and they are shared by setting
---
mail_location:
2008 Jul 06
2
Q: imaptest license
Hi Timo,
I can't find licensing information in http://hg.dovecot.org/imaptest. Can you tell what is the license for this utility? I'd like to package it for ALTLinux Sisyphus repository.
--
Sergey Ivanov
2007 Dec 19
3
array addition
Hi
suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and
a2,b2,c2 respectively.
I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max
(c1,c2))
with
x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min
(b1,b2), c<=min(c1,c2)
and the other bits either x1 or x2 or zero according to whether the
coordinates
are "in range" for
2008 Jul 23
4
Problem: delivery with mode 600 into shared folder
Hi,
I have a problem, delivery called from /etc/aliases file by pipe delivers with mode 0600.
I need system users with shared mail folders (Maildir format).
When I changed alias to pipe to shell wrapper with mode 002 set in it, nothing changed.
MTA is sendmail, OS Solaris, and dovecot version 1.1.1. Can somebody help?
Here are dovecot settings:
---
/opt/dovecot11/sbin/dovecot -n
# 1.1.1:
2005 Dec 16
1
a problem in building dovecot @ opensolaris
Hi,
I'm trying to build dovecot from snapshot dovecot-20051215.tar.gz on
OpenSolaris Nevada build 28.
I have added to the PATH directories for make, gcc and automake/autoconf
(in BASH):
$ export PATH=/opt/sfw/bin:/usr/ccs/bin:/usr/sfw/bin:$PATH
then executed
---
$ aclocal
$ libtoolize --force
$ automake --add-missing
$ autoheader
$ autoconf
---
And then make finished with
---
Install prefix