similar to: Assertion failure in mail-index-transaction.c

I am using exim via dovecot_deliver to store messages in Maildir in my $HOME. I am using kmail to retrieve stuff. Unfortunately, something in my data crashes dovecot. I was using 1.0.rc14 from opensuse, but downloaded and installed 1.0.8 from the site. Here is the crash: Dec 5 18:05:09 h743107 dovecot: IMAP(kris): file mail-index-transaction.c: line 629 (mail_index_update_flags_range):

Just installed the latest (Dec. 12) CVS version and one user keeps getting this assertion failure. Todd dovecot: Dec 13 15:53:01 Error: 29718 imap(username): mbox sync: UID inserted in the middle of mailbox /mailhome/new/o/h/username/mbox (4863 > 3417, seq=780, idx_msgs=1913) dovecot: Dec 13 15:53:06 Error: 29718 imap(username): file mail-index-transaction.c: line 129

To some users happens this assertion failure while deleting a message. dovecot: Mar 10 08:40:44 Panic: IMAP(user): file index-sync.c: line 39 (index_mailbox_set_recent_uid): assertion failed: (seq_range_exists (&ibox->recent_flags, uid)) dovecot: Mar 10 08:40:44 Error: IMAP(user): Raw backtrace: [see bleow] dovecot: Mar 10 08:40:44 Error: child 17683 (imap) killed with signal 6 And the

using latest auto build didn't help. this happens only with a specific account. # doveadm -o imapc_user=----- at domain.com -o imapc_password=---- backup -u =----- at domain.com -R imapc: dsync(---- at domain.com): Panic: pool_data_stack_realloc(): stack frame changed dsync(---- at domain.com): Error: Raw backtrace: /usr/lib/dovecot/libdovecot.so.0(+0x4209a) [0xb762b09a] ->

On 06.12.2016 09:32, Toni Mattila wrote: > Hi, > > On 05-Dec-16 20:28, Toni Mattila wrote: >> Panicing stopped when all index files where deleted. > > It happens again in same user account, so rebuilding indexes didn't > fix it. > > Here's bt full instead of just bt: > #0 0x001d4402 in __kernel_vsyscall () > No symbol table info available. > #1

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

I would like to create a subtotal table with custom bands. seq1 = seq(0, 100, by = 5) seq2 = seq(100, 1000, by = 100) Bands = c(seq1, seq2) #Prices Prices = sample(1:1000, 200, replace=F) #corresponding size for the given price above. size = sample(1:1000, 200, replace=F) How would I find the subtotal of the size based on a given price falls within a band? -- View this message in

R-users, I have two vectors (of timestamps) d1 <- as.POSIXct(strptime("2.2.2002 07:00", format="%d.%m.%Y %H:%M")) d2 <- as.POSIXct(strptime("4.2.2002 07:00", format="%d.%m.%Y %H:%M")) seq1 <- seq(d1, d2, "hours") seq1 d3 <- as.POSIXct(strptime("2.2.2002 15:22", format="%d.%m.%Y %H:%M")) d4 <-

Great R people, I have noticed a strange behaviour in read.delim() and friends in the R 2.7.0 version. I will describe you the problem and also the solution I already found, just to be sure it is an expected behaviour and also to tell people, who may experience the same difficulty, a way to overcome it. And also to see if it is a proper behaviour or maybe a correction is needed. Here is the

Dear RRRRRrrrrrrrrlist! I?ve got two lists which contain sets of DNA-sequences. They look something like this: List of 33 $ Cunonia_atrorubens : chr [1:247] "t" "t" "n" "t" ... $ Cunonia_balansae : chr [1:254] "t" "c" "c" "c" ... $ Cunonia_capensis : chr

Hello Julien, Am Mon, 14 Jan 2019 22:15:47 +0100 schrieb Julien dupont <marcelvierzon at gmail.com>: > ** Test 1 ** > On VPN_office I use 'tcpdump -npi any icmp and host 192.168.1.3' > When pinging 192.168.1.1 from client 1, with no success, I see no packet > passing. Sorry - the tcpdump command should end with "192.168.1.1" instead of

Dear R experts, I have two matrix (seq & mat) & I want to retrieve in a new matrix all the numbers from mat that =1 (corresponding to the same row/ column position) in seq, or all the numbers in mat that =-1 in seq. - Replace all the numbers with NA if it's not 1/-1 in seq. There are some "NA"s in seq. seq=matrix(c(1,-1,0,1,1,-1,0,0,-1,1,1,NA),3,4)

Here's a couple of assertion failures from CVS version as of Oct. 6. There's also a segfault but the core file was empty so I don't know if the log entries are much help. BTW, the searching speed using pine has dramatically improved, nice work! Todd ----------------------------------------- dovecot: Oct 12 12:04:28 Error: 20278 imap(username): file mail-index-sync-ext.c: line 155

Hi, I have yet another problem with Dovecot: sometimes (rarely, maybe once every few days) one of the imap processes will 'hang', consuming all available CPU time. It does not seem to 'finish' in any reasonable amount of time (in one instance I waited a few days). This process will not even exit gracefully, it needs to be killed with 'kill -9 <PID>'. It has

I have three character strings represented below as seq1, seq2, and seq3. Each string has a reference character different from the other. Thus, for seq1, the reference character is U, seq2, S (3rd S from left where A is leftmost character) and for seq3 Y. seq1 = PQRTUWXYseq2 = AQSDSSDHRSseq3 = EEZYJKFFBHO I wish to generate a 3 by 26 matrix where 3 represent seq1, seq2, seq3 and 26 the letters of

Hi, I just took a look into the dovecot 2.1 sources and just saw a possible issue in array.h. This code snippet as an example: #static inline void * #array_get_modifiable_i(struct array *array, unsigned int *count_r) #{ # *count_r = array->buffer->used / array->element_size; # return buffer_get_modifiable_data(array->buffer, NULL); #} array->buffer->used and

Greetings all, I am picking up the work that was started in https://reviews.llvm.org/D27133 — adding support for an element-atomic memcpy/memset/memmove to LLVM. I would appreciate suggestions/thoughts/advice/comments on how to best proceed with this work in a way that will be acceptable to the LLVM group. I apologize in advance; this is going to be a long one... **Background** Loads/stores

Hi suppose I have two arrays x1,x2 of dimensions a1,b1,c1 and a2,b2,c2 respectively. I want x = x1 "+" x2 with dimensions c(max(a1,a2), max(b1,b2),max (c1,c2)) with x[a,b,c] = x1[a1,b1,c1] + x2[a2,b2,c2] if a <=min(a1,a2) , b<=min (b1,b2), c<=min(c1,c2) and the other bits either x1 or x2 or zero according to whether the coordinates are "in range" for

Timo, I saw a couple of these cores over the weekend. The syslog says: May 21 19:04:48 emerald dovecot: [ID 107833 mail.error] IMAP(user): Corrupted index cache file /home/students/s/user/.imap/sent-mail-apr-2004/dovecot.index.cache: indexid changed With a resulting core file from imap at this time. I also discovered a remaining lock file on the person's imap file: -rw------- 1 user

When attempting to save a message from the INBOX to a folder in a collection (like, .projects.dovecot), I get behavior like this (in GDB). Any clue what might be going wrong? Here's where a SIGABRT happens: 280 return array->buffer->used / array->element_size; This is the stack trace: (gdb) where #0 mail_index_map_get_ext_idx (map=0x1200c0db0, ext_id=0,