Displaying 12 results from an estimated 12 matches similar to: "ShortRead with BWA"
2010 Jun 24
1
how to group a large list of strings into categories based on string similarity?
Hi,
I want to group a large list (20 million) of strings into categories
based on string similarity?
The specific problem is: given a list of DNA sequence as below
ACTCCCGCCGTTCGCGCGCAGCATGATCCTG
ACTCCCGCCGTTCGCGCGCNNNNNNNNNNNN
CAGGATCATGCTGCGCGCGAACGGCGGGAGT
CAGGATCATGCTGCGCGCGAANNNNNNNNNN
CAGGATCATGCTGCGCGCGNNNNNNNNNNNN
......
.....
NNNNNNNCCGTTCGCGCGCAGCATGATCCTG
2014 Nov 18
1
ShortRead::FastqStreamer and parallelization
Hi,
I understand ShortRead::FastqStreamer will read chunks in parallel depending on the value of ShortRead:::.set_omp_threads
I see this discussed here: https://stat.ethz.ch/pipermail/bioc-devel/2013-May/004355.html and nowhere else.
It probably should be documented in ShortRead.
Possibly this has already changed for I am using still R 3.1.0. I thought I'd check.
Oh, and, in my
2006 Jul 18
2
how can I delete rows?
Hello, I am very new in R so I am so sorry for this question.
I have the Barro-Lee data set which contains 98 countries and I want to run the regressions only for the Latin America countries, so what do you recomend? How can I delete all the other countries or how can I select the countries of Lat. Am. thank you
this is the list of countries
SHCODE COUNTRY NAME WBCTRY
2009 Aug 27
1
R package install problem
Dear R-Help,
I would be most grateful if you could inspect the attached install file. I would like to be able to use ShortRead to generate QA reports for Genome Analyzer output data.
OS: Linux CentOS 5.3 on HP Proliant server . In process of installing "R" package after configuration flagging some missing modules-libraries the install process will not perform 'make' function.
2012 Oct 26
0
parallel::pvec FUN types differ when v is a list; code simplifications?
In pvec(list(1, 2), FUN, mc.cores=2) FUN sees integer() arguments whereas
pvec(list(1, 2, 3), FUN, mc.cores=2) FUN sees list() arguments; the latter seems
consistent with pvec's description.
This came up in a complicated Bioconductor thread about generics and parallel
evaluation
https://stat.ethz.ch/pipermail/bioc-devel/2012-October/003745.html
One relevant point is that a
2015 Jan 25
0
1/25/2015 10:15:09 AM
http://bwa-surma.org/pndyv/jzvmnxmtdohwbfhplindsrf.mpbpyaydmvosnbmgs
marcotasto at libero.it
1/25/2015 10:15:09 AM
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://lists.digium.com/pipermail/asterisk-users/attachments/20150125/be3cb925/attachment.html>
1998 Jun 02
0
samba interferes with NT server
I have an NT4 server as PDC for a domain: WG. Domain members (on 3
subnets) can either log into the domain, or at least access shares from
the network neighboorhood if they don't want to log on. When I boot a
samba server as a workgroup member (I don't log it into the domain)
everything runs fine for about 24 hours; domain or WG members can access
shares on any machine including the
2010 Oct 09
1
A competition to create a recommendation engine for R packages
Hello everyone.
There is a new competition, outlined on the blog
dataists<http://www.dataists.com/2010/10/using-data-tools-to-find-data-tools-the-yo-dawg-of-data-hacking/>,
inviting us to analyse statistics of the use of R packages (collected from
52 R users), to create a R-package suggestion engine for ourselves.
Since I noticed several bloggers already wrote about it (as I have detailed
2010 Sep 14
2
Multiple CPU HowTo in Linux?
Hello all,
I upgraded my R workstation, and to my dismay, only one core appears to
be used during intensive computation of a bioconductor function.
What I have now is two dual-core Xeon 5160 CPUs and 10 GB RAM. When I
fully load it, top reports about 25% user, 75% idle and 0.98 short-term
load.
The archives gave nothing helpful besides mention of snow. I thought of
posting to HPC, but this system
2010 Jul 21
3
String processing - is there a better way
I have a two part question
Part 1)
I am trying to remove characters in a string based on the position of a key character in another string.? I have a solution that works but it requires a for-loop.? A vectorized way of doing this has alluded me.?
CleanRead<-function(x,y) {
? if (!is.character(x))
??? x <- as.character(x)
? if (!is.character(y))
??? y <- as.character(y)
?
2010 Feb 24
1
build, data and vignettes
Based on some testing it seems to me that if I have a package with
a dataset in /data
a Sweave vignette in inst/doc (but no associated pdf file)
the vignette loads the data in /data through
data(dataset)
and I do a
R CMD build
R will try to build the pdf version of the vignette, but will be
unable to find the dataset in data because the package is not yet
installed. However, if I do
2020 Oct 21
0
Which PCIe cards work with North American BRI & Asterisk?
Which PCIe cards work with North American BRI & Asterisk?
Digium & Sangoma don't support it, according to everything I've read
(their manuals and their tech support).
I think I need National, maybe National 1 or National 2. I already
got an NT-1. I'm getting a few ISDN phones to test the circuit.
I ordered a Dialogic Diva Diva 4BRI - 8 PCI-E 4 Ports Quad 803-031-02B Gu...