similar to: data.frame question

I have a data frame that looks like this: V1 V2 V3 a b 0:1:12 d f 1:2:1 c d 1:0:9 where V3 is in the form x:y:z Can someone show me how to subset the rows where the values of x, y and z <= 10: V1 V2 V3 d f 1:2:1 c d 1:0:9 Thanks Joseph [[alternative HTML version deleted]]

Hello I have 2 data frames df1 and df2. I would like to create a new data frame new_df which will contain only the common rows based on the first 2 columns (chrN and start). The column score in the new data frame should be replaced with a column containing the average score (average_score) from df1 and df2. df1= data.frame(chrN= c(“chr1”, “chr1”, “chr1”, “chr1”, “chr2”, “chr2”, “chr2”),

Hello I have 2 data frames DF1 and DF2 where DF2 is a subset of DF1: DF1= data.frame(V1=1:6, V2= letters[1:6]) DF2= data.frame(V1=1:3, V2= letters[1:3]) How do I create a new data frame of the difference between DF1 and DF2 newDF=data.frame(V1=4:6, V2= letters[4:6]) In my real data, the rows are not in order as in the example I provided. Thanks much Joseph [[alternative HTML version

Hi merge() takes only 2 data frames. What can you do to it to make take more than two data frames? or is there another function that does that? Thanks joseph ____________________________________________________________________________________ Looking for last minute shopping deals? [[alternative HTML version deleted]]

I want to remove the column names from a data frame. I do it the long way, can any body show me a better way ? df= data.frame(chrN= c(“chr1”, “chr2”, “chr3”), start= c(1, 2, 3), end= c(4, 5, 6), score= c(7, 8, 9)) df #I write a txt file without row or column names write.table(df,"df1.txt",sep='\t',quote=FALSE,row.names=F,col.names=F) #then I read it with the header = F

Hi Jim I am trying to prepare a bed file to load as accustom track on the UCSC genome browser. I have a data frame that looks like the one below. > x V1 V2 V3 1 chr1 11255 55 2 chr1 11320 29 3 chr1 11400 45 4 chr2 21680 35 5 chr2 21750 84 6 chr2 21820 29 7 chr2 31890 46 8 chr3 32100 29 9 chr3 52380 29 10 chr3 66450 46 I would like to insert the following 4 lines at the beginning:

Hi Matt Your method is the easiest way for me to install the 64-bit R. I followed the directions on your web site and then did the following: R --arch=x86_64 source("http://bioconductor.org/biocLite.R") biocLite(type = "source",lib = "/Library/Frameworks/R.framework/Versions/2.8/Resources/RLib64") I got many errors and warnings which I copied to the attached file.

Hi Peter I have the following data frame with chromosome name, start and end positions: chrN start end 1 chr1 11122333 11122633 2 chr1 11122333 11122633 3 chr3 11122333 11122633 8 chr3 111273334 111273634 7 chr2 12122334 12122634 4 chr1 21122377 21122677 5 chr2 33122355 33122655 6 chr2 33122355 33122655 I would like to count the positions that have the same start and

Hi I have a character vector with thousands of names which looks like this: > V=c("Fred", "Mary", "SAM") > V [1] "Fred" "Mary" "SAM" > class(V) [1] "character" I would like to change it to a list: > L=as.list(V) > L [[1]] [1] "Fred" [[2]] [1] "Mary" [[3]] [1] "SAM" but I need to

I have a data.frame with all character columns, I would like to convert the last two columns into numeric.> x[1:5, ] chrN start end 1 chr1 71310034 71310064 2 chr14 23354088 23354118 3 chr14 71310034 71310064 4 chr15 37759058 37759088 5 chr22 18262638 18262668 > apply(x, 2, FUN = mode) chrN start end

Dear R list, I'm having difficulties in choosing between a list or a data.frame, or an array for the storage and manipulation of my data (example follows). I've been using the three for different purposes but I would rather like to know which is more adapted to what task. Here is the data I'm currently working on: 200 observations, each observation being a vector of length

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")

Hello I have a data frame and one of its columns is as follows: Col chr1:71310034 chr14:23354088 chr15:37759058 chr22:18262638 chrUn:31337214 chr10_random:4369261 chrUn:3545097 I would like to get rid of colon (:) and replace this column with two new columns containing the terms on each side of the colon. The new columns should look as follows: Col_a Col_b chr1

I've tried various commands. ?plot, Teetor's book, "R Cookbook", and Mittal's book, "R Graphs Cookbook" without seeing how to write the command to create scatterplots from my data.frame. The structure is: > str(chemdata) 'data.frame': 14886 obs. of 4 variables: $ site : Factor w/ 148 levels "BC-0.5","BC-1",..: 104 145 126 115

Dear list, I often need to convert several variables from numeric or integer into factors (before plotting, for instance), as in the following example, d <- data.frame( x = seq(1, 10), y = seq(1, 10), z = rnorm(10), a = letters[1:10]) d2 <- within(d, { x = factor(x) y = factor(y) }) str(d) str(d2) I'd like to write a function factorise() which takes a data.frame and

Dear list, subset has a 'drop' argument that I had often mistaken for the one in [.factor which removes unused levels. Clearly it doesn't work that way, as shown below, d <- data.frame(x = factor(letters[1:15]), y = factor(LETTERS[1:3])) s <- subset(d, y=="A", drop=TRUE) str(s) 'data.frame': 5 obs. of 2 variables: $ x: Factor w/ 15 levels

Hello, I use R 2.10, and I am new in R (I used to use SAS and lately Stata), I am using XP. I have a data which has a data.frame format called x.df (read from a csv file). I want to take from this data observations for which the variable "Code" starts with an "R". I took all the Code and put them into a vector vec<-grep("R[A-Z][A-Z]",x.df$Code,value=TRUE) Then I

Dear list, I have a data.frame with x, y values and a 3-level factor "group", say. I want to create a new column in this data.frame with the values of y scaled to 1 by group. Perhaps the example below describes it best: > x <- seq(0, 10, len=100) > my.df <- data.frame(x = rep(x, 3), y=c(3*sin(x), 2*cos(x), > cos(2*x)), # note how the y values have a different

Dear all, I have a code where I subset a data frame to match entries within levels of an factor (actually, the full script uses three difference factors do do that). I'm very happy with the precision with which I can work with R, but since I loop over factor levels, and the data frame is big, the process is slow. So I've been trying to speed up the process using by(), but I got stuck at

Dear all, Trying to extract a few rows for each element of a list of data.frames, I'm puzzled by the following behaviour, > d <- lapply(1:4, function(i) data.frame(x=rnorm(5), y=rnorm(5))) > str(d) > > lapply(d, "[", i= c(1)) # fine, this extracts the first columns > lapply(d, "[", j= c(1, 3)) # doesn't do nothing ?! > > library(plyr)