similar to: ow to have R automatically print traceback upon errors

I would like to have an automatic traceback printed on error. Is there a way to do this? options(error=traceback) seems to print the previous error, not the current error. I'm guessing this is because the traceback is not set until the error handler is done running. > options(error=traceback) > stop("1") Error: 1 No traceback available > stop("2") Error: 2 1:

Hi I am using R scripts which are running remotely. To make debugging easier, I would like to have the possibility to execute traceback() automatically when an error occurs. Is this possible? OS: Linux Thanks Rainer -- Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation Biology, UCT), Dipl. Phys. (Germany) Centre of Excellence for Invasion Biology Faculty of Science Natural

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hello, I am having a some problems getting SSHD to run on the Ipv6 interface. Interface/Ipv6 Address: ipv6.open-systems.org [kevin at satan kevin/xp-0.0.15] 536 $ping6 ipv6.open-systems.org PING6(56=40+8+8 bytes) 3ffe:1200:3028:ff01::cab --> 3ffe:1200:3028:ff01::caa 16 bytes from 3ffe:1200:3028:ff01::caa, icmp_seq=0 hlim=64 time=73.96 ms sshd_config: ListenAddress

Hi, Is there a way to get the enclosing function name within a function? For example, I would like to have a function getEnclosingFunctionName(). It works like below f = function(){ print(getEnclosingFunctionName()) } f() # will print "f" Thanks Jeff

Hello everyone, I am trying to "parse" a part of LLVM IR. More exactly, from @.str = private unnamed_addr constant [3 x i8] c"DS\00", section "llvm.metadata" I want to get "DS". It is the single place in the whole bytecode from where I can get it. I have : ... Value *VV = cast<Value>(LD100->getOperand(1)->getOperand(0));

PowerDNS supports CAA records beginning with version 4.0, but the pdns package in EPEL for most recent centos versions is stuck at around version 3.4 (3.4.11 is what I have). Do I have no other choice but to manually compile and maintain my own pdns installation? I prefer to avoid this but I need up-to-date features. Perhaps there is a PowerDNS specific work-around? Maybe the EPEL

Hi, Is this method broken in R? I am using it to find roots of the following function: f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100 It is giving an answer of -38.4762403 which is not even close (f(x) = 2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This function should converge.. Even for a simple function like f(x) = exp(-x) * x, it gives

Dear Sirs/Madam, I am a beginner to R, and I am currently working on a data matrix which looks like this: > head(oligo) ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012 AAA 370 631 365 67 164 455 491 KAA 603 1208 170 157 68

Hi, I have a data set similar to the following State Gender Quantity TX Male 1 NY Female 2 TX Male 3 NY Female 4 I need to calculate cumulative sum of the quantity by State and Gender. The expected output is State Gender Quantity CumQuantity TX Male 1 1 TX Male 3 4 NY Female 2 2 NY Female 4 6 I highly appreciate if someone can give me some hints on solving that in R. Hao -- View this

Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>: > > Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit : >> So far, I've only been able to filter HTTP. >> >> Do any of you do transparent HTTPS filtering ? Any suggestions, >> advice, caveats, do's and don'ts ? > > After a week of trial and error, transparent HTTPS filtering

Hi, I have a vector with lots of NAs. e.g. vec = c(NA, NA, 2, NA, NA, 5, NA, 6, NA) > vec [1] NA NA 2 NA NA 5 NA 6 NA I would like to replace NAs with their immediately previous non NA number. After replacement, the above vector will become > vec [1] 0 0 2 2 2 5 5 6 6. I understand how to do that with a loop but the actual vector is very long and the loop takes too much time in R.

Hi, I would like to extract the last row of each group in a data frame. The data frame is as follows Name Value A 1 A 2 A 3 B 4 B 8 C 2 D 3 I would like to get a data frame as Name Value A 3 B 8 C 2 D 3 Thank you for your suggestions in advance Jeff

Hi, I have a a vector and a data frame with two columns vec = c("C", "A", "B") dataDF = data.frame(A1 = c("B", "A", "C"), A2 = c(1,2,3)) I would like to sort the data frame by column A1 such that the order of elements in A1 is as the same as in vec. After the ordering, the data frame would be A1 A2 C

Then, turning to his sister: -----Original Message----- From: colin bird [mailto:syslinux at zytor.com] To: percy wegner; darren russel; nestor left; houston callender; rocco daggett Sent: Friday, February, 2004 2:24 AM Subject: Are the potential target of the virus n_.ow? The l`o,w price on , Allegra, Xe^ni_cal, Xa,_na^x, c~a~rdura and Ultracet is am~^azi,ng. And the m,_ed`s do sell

Hello I have directories named as the names of years eg. 2009 2010 etc. And in this folders eg. 2009 folder there are scanned .tif files like this: 10_09.tif 229_09.tif 3890_09.tif 3890_1_09.tif etc. I would like to samba check correct filenames eg. in folder 2010 there shouldn't be any flies from xxxx_09.tif eg. 229_09.tif only 229_10.tif (_10.tif and vice versa in 2009 there

Hi is it possible to fit a trend line (or some other panel function) through each of multiple data series plotted on the same graph? Specifically, while one can do something like xyplot(a+b+c~x) which plots three series, a,b & c, but can one automatically fit lines through each of them? I suppose one could generate three more variables afit, bfit, and cfit with a model & predict and

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

--==>> OFFICE WATCH <<==-- The Microsoft Office newsletter from Woody's Watch. Your independent source for MS Office advice and news since 1996 17 March 2005 Vol 10 No 10 New! "The Desktop Search Handbook" - http://shop.woodyswatch.com/dsh/ Advertise in Woody's Watch - great rates, great reach, no hard sell. Ask Jan ow.ads@woodyswatch.com 1.

Hi, I currently combine multiple processed data (data frame) into a list and save the list as ".rda" using the save command. When new data come, I load the rda file, process the new data into a data frame, append the data frame to the end of the list, and save the whole list to the disk. The loading and saving steps are quite time consuming. Since I don't need to change the old data