Displaying 20 results from an estimated 1200 matches similar to: "ow to have R automatically print traceback upon errors"
2008 Jan 16
1
Automatic traceback
I would like to have an automatic traceback printed on error. Is there
a way to do this?
options(error=traceback) seems to print the previous error, not the
current error. I'm guessing this is because the traceback is not set
until the error handler is done running.
> options(error=traceback)
> stop("1")
Error: 1
No traceback available
> stop("2")
Error: 2
1:
2009 Mar 06
1
Automatically execute traceback when execution of script causes error?
Hi
I am using R scripts which are running remotely. To make debugging
easier, I would like to have the possibility to execute traceback()
automatically when an error occurs. Is this possible?
OS: Linux
Thanks
Rainer
--
Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation
Biology, UCT), Dipl. Phys. (Germany)
Centre of Excellence for Invasion Biology
Faculty of Science
Natural
2005 Jun 01
2
Different versions, different results ?
Dear all,
I wrote the following batch script on a iMac, and ran it on a linux
mosix cluster.
tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table")
tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib")))
write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")
2001 Jul 04
2
IPv6 and sshd
Hello,
I am having a some problems getting SSHD to run on the Ipv6 interface.
Interface/Ipv6 Address: ipv6.open-systems.org
[kevin at satan kevin/xp-0.0.15] 536 $ping6 ipv6.open-systems.org
PING6(56=40+8+8 bytes) 3ffe:1200:3028:ff01::cab -->
3ffe:1200:3028:ff01::caa
16 bytes from 3ffe:1200:3028:ff01::caa, icmp_seq=0 hlim=64 time=73.96
ms
sshd_config:
ListenAddress
2009 Dec 11
4
get the enclosing function name
Hi,
Is there a way to get the enclosing function name within a function?
For example, I would like to have a function getEnclosingFunctionName().
It works like below
f = function(){
print(getEnclosingFunctionName())
}
f() # will print "f"
Thanks
Jeff
2013 Mar 04
2
[LLVMdev] llvm cannot iterate a [3 x i8]
Hello everyone,
I am trying to "parse" a part of LLVM IR. More exactly, from
@.str = private unnamed_addr constant [3 x i8] c"DS\00", section
"llvm.metadata"
I want to get "DS". It is the single place in the whole bytecode from where
I can get it. I have :
...
Value *VV = cast<Value>(LD100->getOperand(1)->getOperand(0));
2017 Dec 08
2
CAA records using PowerDNS from EPEL
PowerDNS supports CAA records beginning with version 4.0, but the pdns
package in EPEL for most recent centos versions is stuck at around
version 3.4 (3.4.11 is what I have).
Do I have no other choice but to manually compile and maintain my own
pdns installation? I prefer to avoid this but I need up-to-date
features.
Perhaps there is a PowerDNS specific work-around? Maybe the EPEL
2010 Jul 29
7
newton.method
Hi,
Is this method broken in R? I am using it to find roots of the following
function:
f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100
It is giving an answer of -38.4762403 which is not even close (f(x) =
2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This
function should converge..
Even for a simple function like f(x) = exp(-x) * x, it gives
2011 Jun 22
3
Help Needed on Merging Columns by Summation
Dear Sirs/Madam,
I am a beginner to R, and I am currently working on a data matrix which looks like this:
> head(oligo)
ko:K00001 ko:K00003 ko:K00005 ko:K00008 ko:K00009 ko:K00010 ko:K00012
AAA 370 631 365 67 164 455 491
KAA 603 1208 170 157 68
2008 Nov 17
5
how to calculate another vector based on the data from a combination of two factors
Hi,
I have a data set similar to the following
State Gender Quantity
TX Male 1
NY Female 2
TX Male 3
NY Female 4
I need to calculate cumulative sum of the quantity by State and Gender. The
expected output is
State Gender Quantity CumQuantity
TX Male 1 1
TX Male 3 4
NY Female 2 2
NY Female 4 6
I highly appreciate if someone can give me some hints on solving that in R.
Hao
--
View this
2018 Mar 05
7
Squid and HTTPS interception on CentOS 7 ?
Am 05.03.2018 um 13:04 schrieb Nicolas Kovacs <info at microlinux.fr>:
>
> Le 28/02/2018 ? 22:23, Nicolas Kovacs a ?crit :
>> So far, I've only been able to filter HTTP.
>>
>> Do any of you do transparent HTTPS filtering ? Any suggestions,
>> advice, caveats, do's and don'ts ?
>
> After a week of trial and error, transparent HTTPS filtering
2008 Nov 20
2
how to replace NA with previous numbers
Hi,
I have a vector with lots of NAs. e.g.
vec = c(NA, NA, 2, NA, NA, 5, NA, 6, NA)
> vec
[1] NA NA 2 NA NA 5 NA 6 NA
I would like to replace NAs with their immediately previous non NA number.
After replacement, the above vector will become
> vec
[1] 0 0 2 2 2 5 5 6 6.
I understand how to do that with a loop but the actual vector is very long
and the loop takes too much time in R.
2009 Nov 16
8
extracting the last row of each group in a data frame
Hi,
I would like to extract the last row of each group in a data frame.
The data frame is as follows
Name Value
A 1
A 2
A 3
B 4
B 8
C 2
D 3
I would like to get a data frame as
Name Value
A 3
B 8
C 2
D 3
Thank you for your suggestions in advance
Jeff
2009 Dec 02
4
sort a data frame by a vector
Hi,
I have a a vector and a data frame with two columns
vec = c("C", "A", "B")
dataDF = data.frame(A1 = c("B", "A", "C"), A2 = c(1,2,3))
I would like to sort the data frame by column A1 such that the order of
elements in A1 is as the same as in vec.
After the ordering, the data frame would be
A1 A2
C
2004 Sep 24
0
:)) Are the potential target of the virus n_,ow?
Then, turning to his sister:
-----Original Message-----
From: colin bird [mailto:syslinux at zytor.com]
To: percy wegner; darren russel; nestor left; houston callender; rocco
daggett
Sent: Friday, February, 2004 2:24 AM
Subject: Are the potential target of the virus n_.ow?
The l`o,w price on , Allegra, Xe^ni_cal, Xa,_na^x, c~a~rdura and Ultracet
is am~^azi,ng. And the m,_ed`s do sell
2010 Oct 05
2
ow to force samba to allow write specified filename to folder
Hello
I have directories named as the names of years eg. 2009 2010 etc.
And in this folders eg. 2009 folder there are scanned .tif files like
this:
10_09.tif
229_09.tif
3890_09.tif
3890_1_09.tif
etc.
I would like to samba check correct filenames eg. in folder 2010 there
shouldn't be any flies from xxxx_09.tif eg. 229_09.tif only 229_10.tif
(_10.tif and vice versa in 2009 there
2010 Jun 18
1
ow to apply a panel function to each of several data series plotted on the same graph in lattice
Hi
is it possible to fit a trend line (or some other panel function) through each of multiple data series plotted on the same graph? Specifically, while one can do something like
xyplot(a+b+c~x)
which plots three series, a,b & c, but can one automatically fit lines through each of them?
I suppose one could generate three more variables afit, bfit, and cfit with a model & predict and
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2005 Mar 17
0
OW #10.10 - How do you save documents?
--==>> OFFICE WATCH <<==--
The Microsoft Office newsletter from Woody's Watch.
Your independent source for MS Office advice and news since 1996
17 March 2005 Vol 10 No 10
New! "The Desktop Search Handbook" - http://shop.woodyswatch.com/dsh/
Advertise in Woody's Watch - great rates, great reach, no hard sell. Ask Jan ow.ads@woodyswatch.com
1.
2009 Dec 29
1
how to append new data to saved data on disk efficiently
Hi,
I currently combine multiple processed data (data frame) into a list and
save the list as ".rda" using the save command. When new data come, I load
the rda file, process the new data into a data frame, append the data
frame to the end of the list, and save the whole list to the disk. The
loading and saving steps are quite time consuming. Since I don't need to
change the old data