similar to: how to index a list with a string?

Hi, everybody Is there any way to execute a function, which name is stored in a string. such as: a <- "ls()" foo(a) ## same as ls() itself. Or, to execute a R command, which is stored in a string such as: a <- "m1 <- matrix(1:9,3,3)" foo(a) ## same as the assignment itself

Full_Name: Gabor Grothendieck Version: R version 1.9.1, 2004-08-03 OS: Windows XP Submission from: (NULL) (207.35.143.52) The following gives an error: > `a(b)` <- 1:4 > `c(d)` <- (1:4)^2 > lm(`a(b)` ~ `c(d)`) Error in model.matrix.default(mt, mf, contrasts) : model frame and formula mismatch in model.matrix() To fix it replace this line in model.matrix.default:

I searched the forms (i.e., R Search)?and come up with the following suggested link: ?http://cran.r-project.org/doc/FAQ/R-FAQ.html#How-can-I-create-rotated-axis-labels_003f I tried to implement what I believe was being implied by that URL and came up with the below: barplot(WorldPhones[1,], ??????? ylim=c(0, 50000), ??????? axes=FALSE, ann=FALSE, ???????

On Monday 17 December 2007, Christopher Lamb wrote: > On Dec 17, 2007, at 1:22 AM, Torvald Riegel wrote: > > Would it be possible to keep get() unchanged, with a default > > behaviour, plus > > a warning? Otherwise everybody (assuming everybody gets type void*) > > will > > have to update their LLVM passes, and either maintain two versions > > of the >

A user reported a problem with the survdiff function and the use of variables that contain a space.? Here is a simple example.? The same issue occurs in survfit for the same reason. lung2 <- lung names(lung2)[1] <- "in st"?? # old name is inst survdiff(Surv(time, status) ~ `in st`, data=lung2) Error in `[.data.frame`(m, ll) : undefined columns selected In the body of the code

I'm new to R so forgive me if this seems like a simple question: So I have table where the row titles are string variables. When I plot the data with rows along the x-axis, the data is ordered alphabetically as opposed to the order of the table. How can I preserve the row order of the table in the plot? Thanks in advance. -- View this message in context:

Hi, I have a question about the data handling. I have a dataset as following: ID snp1 snp2 snp3 1001 0/0 1/1 1/1 1002 2/2 3/3 1/1 1003 4/4 3/3 2/2 I want to convert the dataset to the following format: ID snp1 snp2 snp3 1001 00 AA AA 1002 GG

I am reading dates in Excel2007 into R. Here are the functions I used: library(RODBC) channel<-odbcConnectExcel2007("myfile.xlsx") tmp<-sqlFetch(channel,"1",as.is=T) The dates in myfile.xlsx are all in this format: mm/dd/yyyy. But when I read it to R, some columns look like "yyyy-mm-dd 00:00:00", some columns look like "yyyy-mm-dd", and some

Hi. How do I plot the straight line and r? in a scatter plot using a simple file x~y? Sueli Rodrigues Eng. Agr?noma - UNESP Mestranda - USP/ESALQ PPG-Solos e Nutri??o de Plantas Fones (19)93442981 (19)33719762

Thanks to Bill Dunlap for the clarification. On follow-up it turns out that this will be an issue for many if not most of the routines in the survival package: a lot of them look at the terms structure and make use of the dimnames of attr(terms, 'factors'), which also keeps the unneeded backquotes. Others use the term.labels attribute. To dodge this I will need to create a

Hi there, I have a data frame with a column named "Flags", whose contents are strings containing any of the following characters, multiple characters allowed: A,B,C,D,E,F,G. Here is the head: GeocodeID PlaceID CountyCode CBSACode StateProvCode PropertyTypeGroupID Flags 1 0 0 0 0 AK 1 ABC 2

Hi, I have been trying a (really simple) push application for the Polycom microbrowser, using a Polycom 650 with 3.2 firmware. I can't do anything, I always get "Push message cannot be displayed" back from the Polycom phone, and all I am sending is the Polycom example : <PolycomIPPhone> <Data priority=?critical?> <h1> Fire Drill at 2pm </h1>

Ben, Looking at your notes, it appears that your solution is to write your own terms() function for lme.? It is easy to verify that the "varnames.fixed" attribute is not returned by the ususal terms function. Then I also need to write my own terms function for the survival and coxme pacakges? Because of the need to treat strata() terms in a special way I manipulate the formula/terms in

Hi, I would really like to have a way to split long string literals across multiple lines in R. Currently, if a string literal spans multiple lines, there is no way to inhibit the introduction of newline characters: > "aaa + bbb" [1] "aaa\nbbb" If a line ends with a backslash, it is just ignored: > "aaa\ + bbb" [1] "aaa\nbbb" We could use

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

Dear R guru: If I got a variable aaa<- "up.6.11(16)" how can I extract 16 out of the bracket? I could use substr, e.g. substr(aaa, start=1, stop=2) [1] "up" But it needs start and stop, what if my start or stop is not fixed, I just want the number inside the bracket, how can I achieve this? Many thanks yan

On Wed, 14 Jun 2017 06:12:09 -0500, Duncan Murdoch <murdoch.duncan at gmail.com> wrote: > On 14/06/2017 5:58 AM, Andreas Kersting wrote: > > Hi, > > > > I would really like to have a way to split long string literals across > > multiple lines in R. > > I don't understand why you require the string to be a literal. Why not > construct the long

Dear all, I have two data frames- x1 and y1 with same row names and column names(actually the names of the patients). x1 a b c d e a 1.0000000 0.4730679 0.6226994 0.6036036 0.6433333 b 0.4730679 1.0000000 0.6227273 0.6303855 0.5730858 c 0.6226994 0.6227273 1.0000000 0.7290503 0.6900585 d 0.6036036 0.6303855 0.7290503 1.0000000

I am trying to use the angle option in polygon to create polygons filled with horizontal and vertical lines. The polygons I am crating are irregular and it the angle function appears to set the angle of the shading perpendicular to the polygon sides rather than perpendicular to the axes. Is there any way to set the angle relative to the axes rather than relative to the polygon sides?

Dear R-Helpers, this is my first post ever to a mailing list, so please feel free to point out any missunderstandings on my side regarding the conventions of this mailing list. My problem: Assuming the following character vector is given: names <- c("filia Maria", "vidua Joh Dirck Kleve (oo 02.02.1732)", "Bernardus Engelb Franciscus Linde j.u.Doktor referendarius