Displaying 20 results from an estimated 10000 matches similar to: "how to index a list with a string?"
2009 Nov 02
2
How to execute a funcition which name is stored in a string?
Hi, everybody
Is there any way to execute a function, which name is stored in a string.
such as:
a <- "ls()"
foo(a) ## same as ls() itself.
Or, to execute a R command, which is stored in a string
such as:
a <- "m1 <- matrix(1:9,3,3)"
foo(a) ## same as the assignment itself
2004 Aug 28
6
model.matrix.default chokes on backquote (PR#7202)
Full_Name: Gabor Grothendieck
Version: R version 1.9.1, 2004-08-03
OS: Windows XP
Submission from: (NULL) (207.35.143.52)
The following gives an error:
> `a(b)` <- 1:4
> `c(d)` <- (1:4)^2
> lm(`a(b)` ~ `c(d)`)
Error in model.matrix.default(mt, mf, contrasts) :
model frame and formula mismatch in model.matrix()
To fix it replace this line in model.matrix.default:
2009 Dec 01
1
Aligning Diagonally Oriented Labels Under Bar Chart
I searched the forms (i.e., R Search)?and come up with the following suggested link:
?http://cran.r-project.org/doc/FAQ/R-FAQ.html#How-can-I-create-rotated-axis-labels_003f
I tried to implement what I believe was being implied by that URL and came up with the below:
barplot(WorldPhones[1,],
??????? ylim=c(0, 50000),
??????? axes=FALSE, ann=FALSE,
???????
2007 Dec 17
2
[LLVMdev] PointerType API Change
On Monday 17 December 2007, Christopher Lamb wrote:
> On Dec 17, 2007, at 1:22 AM, Torvald Riegel wrote:
> > Would it be possible to keep get() unchanged, with a default
> > behaviour, plus
> > a warning? Otherwise everybody (assuming everybody gets type void*)
> > will
> > have to update their LLVM passes, and either maintain two versions
> > of the
>
2018 Mar 05
2
backquotes and term.labels
A user reported a problem with the survdiff function and the use of variables that contain
a space.? Here is a simple example.? The same issue occurs in survfit for the same reason.
lung2 <- lung
names(lung2)[1] <- "in st"?? # old name is inst
survdiff(Surv(time, status) ~ `in st`, data=lung2)
Error in `[.data.frame`(m, ll) : undefined columns selected
In the body of the code
2008 Dec 11
5
Row order in plot
I'm new to R so forgive me if this seems like a simple question:
So I have table where the row titles are string variables. When I plot the
data with rows along the x-axis, the data is ordered alphabetically as
opposed to the order of the table.
How can I preserve the row order of the table in the plot?
Thanks in advance.
--
View this message in context:
2010 Aug 05
2
questions about string handling
Hi, I have a question about the data handling. I have a dataset as following:
ID snp1 snp2 snp3
1001 0/0 1/1 1/1
1002 2/2 3/3 1/1
1003 4/4 3/3 2/2
I want to convert the dataset to the following format:
ID snp1 snp2 snp3
1001 00 AA AA
1002 GG
2010 Jul 29
4
reading dates in Excel into R
I am reading dates in Excel2007 into R.
Here are the functions I used:
library(RODBC)
channel<-odbcConnectExcel2007("myfile.xlsx")
tmp<-sqlFetch(channel,"1",as.is=T)
The dates in myfile.xlsx are all in this format: mm/dd/yyyy. But when I read it to R, some columns look like "yyyy-mm-dd 00:00:00", some columns look like "yyyy-mm-dd", and some
2009 Apr 02
2
Scatter plot
Hi. How do I plot the straight line and r? in a scatter plot using a
simple file x~y?
Sueli Rodrigues
Eng. Agr?noma - UNESP
Mestranda - USP/ESALQ
PPG-Solos e Nutri??o de Plantas
Fones (19)93442981
(19)33719762
2018 Mar 07
1
backquotes and term.labels
Thanks to Bill Dunlap for the clarification. On follow-up it turns out that this will be
an issue for many if not most of the routines in the survival package: a lot of them look
at the terms structure and make use of the dimnames of attr(terms, 'factors'), which also
keeps the unneeded backquotes. Others use the term.labels attribute. To dodge this I
will need to create a
2010 Apr 27
4
Selecting rows based on contents of string
Hi there,
I have a data frame with a column named "Flags", whose contents are strings
containing any of the following characters, multiple characters allowed:
A,B,C,D,E,F,G.
Here is the head:
GeocodeID PlaceID CountyCode CBSACode StateProvCode PropertyTypeGroupID
Flags
1 0 0 0 0
AK 1 ABC
2
2009 Sep 24
4
Polycom push application for microbrowser
Hi,
I have been trying a (really simple) push application for the Polycom
microbrowser, using a Polycom 650 with 3.2 firmware.
I can't do anything, I always get "Push message cannot be displayed" back
from the Polycom phone, and all I am sending is the Polycom example :
<PolycomIPPhone>
<Data priority=?critical?> <h1> Fire Drill at 2pm </h1>
2018 Mar 08
4
Fwd: Re: [EXTERNAL] Re: backquotes and term.labels
Ben,
Looking at your notes, it appears that your solution is to write your own terms() function
for lme.? It is easy to verify that the "varnames.fixed" attribute is not returned by the
ususal terms function.
Then I also need to write my own terms function for the survival and coxme pacakges?
Because of the need to treat strata() terms in a special way I manipulate the
formula/terms in
2017 Jun 14
8
[WISH / PATCH] possibility to split string literals across multiple lines
Hi,
I would really like to have a way to split long string literals across
multiple lines in R.
Currently, if a string literal spans multiple lines, there is no way to
inhibit the introduction of newline characters:
> "aaa
+ bbb"
[1] "aaa\nbbb"
If a line ends with a backslash, it is just ignored:
> "aaa\
+ bbb"
[1] "aaa\nbbb"
We could use
2011 Jun 15
4
R string functions
Hi,
I have a string "GGGGGGCCCAATCGCAATTCCAATT"
What I want to do is to count the percentage of each letter in the string,
what string functions can I use to count the number of each letter appearing
in the string?
For example, the letter "A" appeared 6 times, letter "T" appeared 5 times,
how can I use a string function to get the these number?
thanks,
karena
2011 Feb 01
3
R string help
Dear R guru:
If I got a variable
aaa<- "up.6.11(16)"
how can I extract 16 out of the bracket?
I could use substr, e.g.
substr(aaa, start=1, stop=2)
[1] "up"
But it needs start and stop, what if my start or stop is not fixed, I
just want the number inside the bracket, how can I achieve this?
Many thanks
yan
2017 Jun 14
4
[WISH / PATCH] possibility to split string literals across multiple lines
On Wed, 14 Jun 2017 06:12:09 -0500, Duncan Murdoch <murdoch.duncan at gmail.com> wrote:
> On 14/06/2017 5:58 AM, Andreas Kersting wrote:
> > Hi,
> >
> > I would really like to have a way to split long string literals across
> > multiple lines in R.
>
> I don't understand why you require the string to be a literal. Why not
> construct the long
2011 Oct 31
3
Plot two matrices and keeping the record of row names
Dear all,
I have two data frames- x1 and y1 with same row names and column names(actually the names of the patients).
x1
a b c d e
a 1.0000000 0.4730679 0.6226994 0.6036036 0.6433333
b 0.4730679 1.0000000 0.6227273 0.6303855 0.5730858
c 0.6226994 0.6227273 1.0000000 0.7290503 0.6900585
d 0.6036036 0.6303855 0.7290503 1.0000000
2016 Apr 27
4
polygon angle option perpendicular to axis
I am trying to use the angle option in polygon to create polygons filled with horizontal and vertical lines. The polygons I am crating are irregular and it the angle function appears to set the angle of the shading perpendicular to the polygon sides rather than perpendicular to the axes. Is there any way to set the angle relative to the axes rather than relative to the polygon sides?
2011 Nov 08
2
match first consecutive list of capitalized words in string
Dear R-Helpers,
this is my first post ever to a mailing list, so please feel free to point out any missunderstandings on my side regarding the conventions of this mailing list.
My problem:
Assuming the following character vector is given:
names <- c("filia Maria", "vidua Joh Dirck Kleve (oo 02.02.1732)", "Bernardus Engelb Franciscus Linde j.u.Doktor referendarius